Command line: [/mnt/NFS_UPF/soft/exonerate/exonerate-2.2.0-x86_64/bin/exonerate -m p2g --showtargetgff --exhaustive yes -q query19 -t q_subseq] Hostname: [am30751-101042u] C4 Alignment: ------------ Query: SPP00000113_1.0 # Protein # Selenoprotein M (SelM) # Mus musculus # Complete Target: PVKD010014587.1:subseq(1,33745) Cricetomys gambianus isolate US082 CriGam_scaffold_29155, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 643 Query range: 0 -> 145 Target range: 5927 -> 3784 1 : MetSerIleLeuLeuSerProProSerLeuLeuLeuLeuLeuAlaAlaLeuValAlaProAl : 21 |||||||||||| |||||| ||||||||||||||||||||||||||||||||||| MetSerIleLeuProLeuProProProLeuLeuLeuLeuLeuAlaAlaLeuValAlaProAl 5927 : ATGAGTATCCtaccgctgccgccgccgctgctgctgcttctcGCGGCCCTTGTGGCTCCagc : 5867 22 : aThrSerThrThrAsnTyrArgProAspTrpAsnArgLeuArgGlyLeuAlaArgGlyArgV : 42 ||||:::...|||...|||||||||||||||||||||||||||||||||||||||||||||| aThrAlaAlaThrThrTyrArgProAspTrpAsnArgLeuArgGlyLeuAlaArgGlyArgV 5866 : caccgccgccaccacctACCGACCGGACTGGAACCGTCTTCGAGGCCTGGCCAGGGGGCGGG : 5804 43 : alGlu >>>> Target Intron 1 >>>> ThrCysGlyGlyUnkGlnLeuAsnArgL : 53 ||||| 1184 bp |||||||||||| ||||||||||||| alGlu++ ++ThrCysGlyGly***GlnLeuAsnArgL 5803 : TGGAGgt.........................agACCTGCGGAGGATGACAATTGAATCGCC : 4587 54 : euLysGlu >>>> Target Intron 2 >>>> ValLysAlaPheValThrGluAspI : 64 |||||||| 153 bp ||||||||||||||||||:!!|||: euLysGlu++ ++ValLysAlaPheValThrGlnAspL 4586 : TAAAGGAGgt.........................agGTGAAGGCCTTTGTCACCCAGGACC : 4401 65 : leGlnLeu{Ty} >>>> Target Intron 3 >>>> {r}HisAsnLeuValMetLys : 73 !!||||||{||} 303 bp {|}|||||||||||||||||| euGlnLeu{Ty}++ ++{r}HisAsnLeuValMetLys 4400 : TCCAGCTG{TA}gt.........................ag{C}CACAACCTGGTGATGAAG : 4071 74 : HisLeuProGlyAlaAspProGluLeuValLeuLeuSerArgAsnTyrGlnGluLeuGlu : 94 ||||||||||||||||||||||||||||||||||||||||||||||||!!.||||||||| HisLeuProGlyAlaAspProGluLeuValLeuLeuSerArgAsnTyrHisGluLeuGlu++ 4070 : CACCTCCCTGGGGCAGACCCCGAACTTGTGCTGTTAAGCCGGAATTACCATGAACTAGAGgt : 4008 95 : >>>> Target Intron 4 >>>> ArgIleProLeuSerGlnMetThrArgAspGluIl : 105 68 bp |||||||||||||||:!!||||||||||||||||| ++ArgIleProLeuSerGluMetThrArgAspGluIl 4007 : .........................agCGCATCCCACTCAGCGAAATGACTCGTGACGAGAT : 3907 106 : eAsnAlaLeuValGlnGluLeuGlyPheTyrArgLysSerAlaProGluAlaGlnValProP : 126 ||||||||||||||||||||||||||||||||||||||||||||||!!:||||||||||||| eAsnAlaLeuValGlnGluLeuGlyPheTyrArgLysSerAlaProAspAlaGlnValProP 3906 : CAACGCGCTGGTACAGGAGCTCGGCTTCTACCGAAAGTCGGCGCCGGACGCGCAAGTGCCCC : 3844 127 : roGluTyrLeuTrpAlaProAlaLysProProGluGluAlaSerGluHisAspAspLeu : 145 |||||:!!|||||||||||||||||||||||||||!!:|||||||||!.!! !|||||| roGluHisLeuTrpAlaProAlaLysProProGluAspAlaSerGluArgAlaAspLeu 3843 : CCGAGCACCTGTGGGCGCCCGCTAAGCCCCCCGAGGACGCGTCCGAGCGTGCCGACCTG : 3785 vulgar: SPP00000113_1.0 0 145 . PVKD010014587.1:subseq(1,33745) 5927 3784 - 643 M 43 129 5 0 2 I 0 1180 3 0 2 M 12 36 5 0 2 I 0 149 3 0 2 M 11 33 S 0 2 5 0 2 I 0 299 3 0 2 S 1 1 M 26 78 5 0 2 I 0 64 3 0 2 M 52 156 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2019-11-20 ##type DNA # # # seqname source feature start end score strand frame attributes # PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local gene 3785 5927 643 - . gene_id 1 ; sequence SPP00000113_1.0 ; gene_orientation + PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local cds 5799 5927 . - . PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local exon 5799 5927 . - . insertions 0 ; deletions 0 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice5 5797 5798 . - . intron_id 1 ; splice_site "GT" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local intron 4615 5798 . - . intron_id 1 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice3 4615 4616 . - . intron_id 0 ; splice_site "AG" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local cds 4579 4614 . - . PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local exon 4579 4614 . - . insertions 0 ; deletions 0 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice5 4577 4578 . - . intron_id 2 ; splice_site "GT" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local intron 4426 4578 . - . intron_id 2 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice3 4426 4427 . - . intron_id 1 ; splice_site "ag" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local cds 4391 4425 . - . PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local exon 4391 4425 . - . insertions 0 ; deletions 0 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice5 4389 4390 . - . intron_id 3 ; splice_site "GT" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local intron 4088 4390 . - . intron_id 3 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice3 4088 4089 . - . intron_id 2 ; splice_site "AG" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local cds 4009 4087 . - . PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local exon 4009 4087 . - . insertions 0 ; deletions 0 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice5 4007 4008 . - . intron_id 4 ; splice_site "GT" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local intron 3941 4008 . - . intron_id 4 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local splice3 3941 3942 . - . intron_id 3 ; splice_site "AG" PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local cds 3785 3940 . - . PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local exon 3785 3940 . - . insertions 0 ; deletions 0 PVKD010014587.1:subseq(1,33745) exonerate:protein2genome:local similarity 3785 5927 643 - . alignment_id 1 ; Query SPP00000113_1.0 ; Align 5928 1 129 ; Align 4615 44 36 ; Align 4426 56 33 ; Align 4087 68 78 ; Align 3941 94 156 # --- END OF GFF DUMP --- # -- completed exonerate analysis