Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q ../eEFSec-human.fa -t eEFSec-NIVO01001699.1.subseq] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 127 Query range: 39 -> 427 Target range: 7407 -> 204657 40 : ProGlnSerArgGluArgGlyIleThrLeuAspLeuGlyPheSerCysPheSerValP : 59 |||!:!.!!!:! ! !|||! !!:! ! !! ! !.!.:!:||| |||::: ProArgGlyGlnIleProGlyThrSerAlaProCysProLeuAlaCysProSerLeuS 7408 : CCCCGAGGCCAAATTCCCGGGACCAGCGCTCCCTGCCCCCTGGCgtgtccttccctct : 7465 60 : roLeuProAlaArg{Le} >>>> Target Intron 1 >>>> {u}ArgSerSe : 67 ||||||||||||{ } 5779 bp {!}!.!:!!|| erLeuProAlaArg{Gl}++ ++{y}AsnAlaSe 7466 : ccctccctgctcgG{GG}gt.........................ag{C}AATGCCTC : 13268 68 : rLeuProGluPheGlnAlaAlaProGluAlaGluProGluProGlyGluProLeuLeu : 86 |:!!|||....!!||| ! !!! !!!: ! !||| ! !! !!..! !|||||| rValProArgLeuGlnTrpProGlnAspHisTrpProTrpSerArgArgGlyLeuLeu 13269 : GGTCCCTCGTCTCCAGTGGCCTCAGGACCACTGGCCCTGGTCGCGGAGGGGCCTCCTT : 13325 87 : GlnValThrLeuValAspCysProGlyHisAlaSerLeuIleArgThr{I} >>>> : 103 :!! !! ! !|||||||||! !...!.!! ! !.!! !|||{ } AlaIleGluSerSerAspCysProValArgValIleThrPheAspThr{A}++ 13326 : GCCATCGAATCTTCCGACTGCCCAGTGAGAGTCATCACATTCGACACA{G}gt..... : 13379 104 : Target Intron 2 >>>> {le}IleGlyGlyAlaGlnIleIleAspLeuMetMe : 114 6618 bp { !}::!|||! !!.!||| |||..! !:!::! +-{la}ValGlyGluGlyGlnGlyIleSerLysLeuVa 13380 : ....................ac{ct}gtAGGCGAAGGCCAAGGGATTTCCAAACTCGT : 20027 115 : tLeuValIleAspValThrLysGlyMetGlnThrGlnSerAlaGluCysLeuVal > : 133 :! !|||! ! ! !|||||||||:!! !|||..! ! !!...|||! ! ! lProValThrIleProThrLysGlyLeuGlyThrSerHisProArgCysHisSer++ 20028 : CCCAGTCACCATTCCCACTAAGGGTCTGGGAACTTCACACCCTCGCTGCCACTCAgt. : 20086 134 : >>> Target Intron 3 >>>> IleGlyGlnIleAlaCysGlnLysLeu{Va} : 142 14807 bp !..!:!!:!!!.!|||:::::::::{! } ++ProSerGluLeuGlyCysArgArgVal{Gl}+ 20087 : ........................agCCATCAGAGCTTGGGtgcaggagggtg{gg}g : 34920 143 : >>>> Target Intron 4 >>>> {l}ValValLeuAsnLysIleAspLeu > : 151 2314 bp {!}..!||||||...|||:!!.!.||| + ++{y}ThrValLeuGlyLysValGlnLeu++ 34921 : t.........................ag{A}ACAGTTTTAGGAAAAGTACAACTGgt. : 37261 152 : >>> Target Intron 5 >>>> LeuProGluGlyLysArgGlnAlaAlaIleAs : 161 24839 bp :!!||||||||| |||:!!:!!.!! !! ++ValProGluGlyAlaArgGluSerThrProGl 37262 : ........................agGTTCCCGAGGGTGCCCGAGAATCCACTCCAGG : 62128 162 : pLysMetThr{Ly} >>>> Target Intron 6 >>>> {s}Lys{Me} >>> : 167 !!..:!! !{!:} 23859 bp {!}|||{! } ySerValTyr{Ar}++ ++{g}Lys{Se}++ 62129 : CAGCGTGTAC{AG}gt.........................ag{G}AAG{AG}gt... : 86009 168 : > Target Intron 7 >>>> {t}GlnLysThrLeuGluAsnThrLysPheArg{ : 178 9964 bp { }|||||| ! ! !!..||| ! !::|||{ ++{r}GlnLysLeuArgLeuThrThrHisTrpArg{ 86010 : ......................ag{T}CAGAAACTAAGGCTAACGACACACTGGAGG{ : 96002 179 : Gl} >>>> Target Intron 8 >>>> {y}AlaProIleIleProValAla : 186 ||} 13218 bp {|} !|||! ! |||..!||| Gl}++ ++{y}LeuProThrAlaProThrAla++ 96003 : GG}gt.........................ag{G}CTCCCCACCGCGCCCACCGCTgt : 109244 187 : >>>> Target Intron 9 >>>> AlaLysProGlyGlyProGluAlaProGluT : 196 13018 bp ||| !||| !!||||||..!||||||!!: ++AlaGlyProArgGlyProArgAlaProAspG 109245 : .........................agGCTGGGCCACGTGGTCCGCGGGCACCAGACG : 122292 197 : hrGlu >>>> Target Intron 10 >>>> AlaProGlnGly >>>> Targ : 202 !..! 1646 bp |||||||||||| lyArg++ ++AlaProGlnGly++ 122293 : GCAGGgt..........................agGCCCCCCAGGGGgt......... : 123958 203 : et Intron 11 >>>> IleProGluLeuIle{Gl} >>>> Target Intron : 207 15762 bp .!! !|||||| !{..} 7219 bp ++PheTyrGluLeuAla{Ar}++ 123959 : .................agTTTTACGAATTGGCC{AG}gt.................. : 139737 208 : 12 >>>> {u}LeuLeuThrSerGlnIleSerIleProThrArgAspProSer > : 222 {!} :!!! !||||||! !||| !||| !|||..!|||..! ++{g}ProValArgSerGlnSerSerArgProGlnArgSerProGln+- 139738 : ........ag{g}cctGTGAGGTCTCAGAGCAGCCGCCCCCAGCGCAGCCCCCAGgc. : 146999 223 : >>> Target Intron 13 >>>> GlyProPheLeuMetSerValAspHisCysP : 232 2895 bp !.! !!!:::!!:!! !! ! !! !| ++AlaThrTrpMetLeuArgProHisAlaProP 147000 : .........................agGCCACCTGGATGCTGCGCCCACACGCACCCT : 149922 233 : heSerIleLysGlyGlnGlyThrValMetThrGlyThrIleLeuSerGlySerIleSe : 251 ||..! !:!! !.!.||| !!..!:!:||| !!.! !!!! |||...:::.. heGlnAlaGlnHisAspGlyProThrLeuThrProAsnSerPheTrpGlyLysValLy 149923 : TCCAGGCACAACACGATGGGCCAACCCTCACGCCAAACTCATTTtgggggaaagtgaa : 149979 252 : r{Le} >>>> Target Intron 14 >>>> {u}GlyAspSerValGluIlePr : 259 .{ } 9667 bp {!}|||! !|||:!!||| !|| s{Ly}+- ++{s}GlyGlySerLeuGluCysPr 149980 : a{aa}ga..........................ag{G}GGCGGCAGCTTGGAGTGTCC : 159670 260 : oAlaLeu{Ly} >>>> Target Intron 15 >>>> {s}ValValLysLysVa : 267 |||| !{::} 13265 bp {!}|||:!!||| !|| oAlaLys{Ar}++ ++{g}ValIleLysLeuVa 159671 : AGCGAAA{CG}gt..........................ag{A}GTTATTAAACTGGT : 172959 268 : lLys >>>> Target Intron 16 >>>> SerMetGlnMetPheHisMetPro : 276 | ! 12553 bp .!! !!.:!: !:!!||| lVal++ ++GlySerHisLeuArgSerLeuPro 172960 : AGTGgt..........................agGGCTCCCATCTCAGGAGCTTGCCT : 185539 277 : IleThr >>>> Target Intron 17 >>>> SerAlaMetGlnGlyAspArgL : 286 :!: ! 652 bp ::: ..!||||||| LeuGln++ ++AlaLeuAlaThrAlaAspArgL 185540 : CTGCAAgt..........................aggccctggcaaccgCTGATCGAC : 186221 287 : euGlyIleCysValThrGlnPheAspProLysLeuLeuGluArgGlyLeuValCysAl : 305 || !!.!.|||::: |||... ...:::::: ! ! euCysPheCysIlePheAlaPheSerGluHisPheIleLysIleGluSerCysAsnMe 186222 : TTTGTTTctgtatatttgccttttctgaacacttcataaaaatagaatcatGCAACAT : 186278 306 : aProGluSerLeuHisThrValHisAlaAlaLeuIle >>>> Target Intron : 318 ! !...! !:!!:!! ! !! !:!! !:!!:!: 3299 bp tTyrSerIleMetTyrGlyPheSerSer***ValLeu++ 186279 : GTATTCTATTATGTATGGCTTTTCCTCCTGAGTCCTGgt................... : 186319 319 : 18 >>>> SerValGluLysIleProTyrPheArgGlyProLeuGlnThrLysAlaL : 334 .!!! !:!! ! |||! !! !.!.! !|||! !|||..!! ! !| ++GlyGlyGlnAspIleLeuSerMetMetGlyGlnLeuMetLysProLysL 186320 : .......agGGGGGACAAGATATCCTGTCTATGATGGGCCAGCTCATGAAGCCCAAGA : 189664 335 : ysPheHisIleThr{V} >>>> Target Intron 19 >>>> {al}GlyHisG : 342 || .!.||||||{!} 1267 bp { !} !|||. ysThrGluIleThr{G}++ ++{ly}ProHisA 189665 : AGACGGAGATCACA{G}gt..........................ag{GG}CCGCATC : 190955 343 : luThrValMetGlyArgLeu{M} >>>> Target Intron 20 >>>> {et}P : 350 .. !! !:!:!.!||| { } 6634 bp { } rgProCysValAlaArgArg{A}++ ++{sp}H 190956 : GCCCGTGCGTCGCCCGtcga{g}gt..........................ag{AT}C : 197613 351 : hePheSerProAlaProAspAsnPheAspGlnGlu{Pr} >>>> Target Intro : 362 !! ..!|||::!||||||!.. ||||||.!.{! } 3587 bp is***AspProSerProAspArgArgAspGlnHis{Hi}++ 197614 : ATTAAGATCCGAGCCCAGACAGAAGGGATCAACAT{CA}gt................. : 197653 363 : n 21 >>>> {o}IleLeuAspSerPheAsnPheSerGlnGluTyrLeuPheGln : 377 {!}:!: !..!:!!! !::! .!! :!! ! !!::||| ++{s}LeuSerSerAlaCysSerGlyGlyPheGlnGlnSerTrpGln++ 197654 : .........ag{C}CTGAGCAGTGCCTGCTCTGGAGGGTTCCAGCAGAGCTGGCAggt : 201281 378 : >>>> Target Intron 22 >>>> GluGlnTyrLeuSerLysAspLeuThrPro : 386 3221 bp ! !|||||| ! !!!:!! ||| !!||| ++GlyGlnTyrAlaProArgGlyLeuProPro 201282 : ..........................agGGGCAGTACGCACCCAGGGGGCTCCCTCCA : 204529 387 : AlaValThrAspAsnAspGluAlaAspLysLysAlaGly<->GlnAlaThrGluGlyH : 405 !.! !||| !.!.! !! !||| !!!....|||||| |||! ! ! ! GlySerThrProGlnAlaAlaAlaProAsnSerAlaGlyProGlnGluGlyLeuPro* 204530 : GGGAGCACCCCTCAGGCTGCAGCACCTAACTCTGCTGGTCCCCAAGAGGGGCTTCCCT : 204589 406 : isCysProArgGlnGlnTrpAlaLeuValGluPheGluLysProValThrCysProAr : 424 ! ! ||| !::!::!||| !!!!:!!..!! !..!..!|||:!!! !... !|| **ArgProLeuArgArgTrp***PheLeuArgSerArgSerProIleIleAlaAsnAr 204590 : AAAGGCCTTTGAGAAGGTGGTAATTCCTAAGATCTAGGTCACCTATTATTGCAAACAG : 204646 425 : gLeuCysLeu : 427 |:!!|||||| gIleCysLeu 204647 : AATTTGTCTC : 204657 vulgar: SPP00000038_1.0 39 427 . NIVO01001699.1:subseq(3461309,210250) 7407 204657 + 127 M 24 72 S 0 2 5 0 2 I 0 5775 3 0 2 S 1 1 M 38 114 S 0 1 5 0 2 I 0 6614 3 0 2 S 1 2 M 29 87 5 0 2 I 0 14803 3 0 2 M 9 27 S 0 2 5 0 2 I 0 2310 3 0 2 S 1 1 M 8 24 5 0 2 I 0 24835 3 0 2 M 14 42 S 0 2 5 0 2 I 0 23855 3 0 2 S 1 1 M 1 3 S 0 2 5 0 2 I 0 9960 3 0 2 S 1 1 M 10 30 S 0 2 5 0 2 I 0 13214 3 0 2 S 1 1 M 7 21 5 0 2 I 0 13014 3 0 2 M 12 36 5 0 2 I 0 1642 3 0 2 M 4 12 5 0 2 I 0 15758 3 0 2 M 5 15 S 0 2 5 0 2 I 0 7215 3 0 2 S 1 1 M 14 42 5 0 2 I 0 2891 3 0 2 M 30 90 S 0 2 5 0 2 I 0 9663 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 13261 3 0 2 S 1 1 M 6 18 5 0 2 I 0 12549 3 0 2 M 10 30 5 0 2 I 0 648 3 0 2 M 39 117 5 0 2 I 0 3295 3 0 2 M 21 63 S 0 1 5 0 2 I 0 1263 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 6630 3 0 2 S 1 2 M 12 36 S 0 2 5 0 2 I 0 3583 3 0 2 S 1 1 M 14 42 5 0 2 I 0 3217 3 0 2 M 23 69 G 0 3 M 28 84 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 7408 204657 127 + . gene_id 1 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 7408 7481 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 7408 7481 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 7482 7483 . + . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 7482 13260 . + . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 13259 13260 . + . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 13261 13376 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 13261 13376 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 13377 13378 . + . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 13377 19994 . + . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 19993 19994 . + . intron_id 1 ; splice_site "ac" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 19995 20083 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 19995 20083 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 20084 20085 . + . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 20084 34890 . + . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 34889 34890 . + . intron_id 2 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 34891 34919 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 34891 34919 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 34920 34921 . + . intron_id 4 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 34920 37233 . + . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 37232 37233 . + . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 37234 37258 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 37234 37258 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 37259 37260 . + . intron_id 5 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 37259 62097 . + . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 62096 62097 . + . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 62098 62141 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 62098 62141 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 62142 62143 . + . intron_id 6 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 62142 86000 . + . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 85999 86000 . + . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 86001 86006 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 86001 86006 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 86007 86008 . + . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 86007 95970 . + . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 95969 95970 . + . intron_id 6 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 95971 96003 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 95971 96003 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 96004 96005 . + . intron_id 8 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 96004 109221 . + . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 109220 109221 . + . intron_id 7 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 109222 109243 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 109222 109243 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 109244 109245 . + . intron_id 9 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 109244 122261 . + . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 122260 122261 . + . intron_id 8 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 122262 122297 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 122262 122297 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 122298 122299 . + . intron_id 10 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 122298 123943 . + . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 123942 123943 . + . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 123944 123955 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 123944 123955 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 123956 123957 . + . intron_id 11 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 123956 139717 . + . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 139716 139717 . + . intron_id 10 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 139718 139734 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 139718 139734 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 139735 139736 . + . intron_id 12 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 139735 146953 . + . intron_id 12 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 146952 146953 . + . intron_id 11 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 146954 146996 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 146954 146996 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 146997 146998 . + . intron_id 13 ; splice_site "GC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 146997 149891 . + . intron_id 13 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 149890 149891 . + . intron_id 12 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 149892 149983 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 149892 149983 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 149984 149985 . + . intron_id 14 ; splice_site "ga" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 149984 159650 . + . intron_id 14 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 159649 159650 . + . intron_id 13 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 159651 159680 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 159651 159680 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 159681 159682 . + . intron_id 15 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 159681 172945 . + . intron_id 15 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 172944 172945 . + . intron_id 14 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 172946 172964 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 172946 172964 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 172965 172966 . + . intron_id 16 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 172965 185517 . + . intron_id 16 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 185516 185517 . + . intron_id 15 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 185518 185547 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 185518 185547 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 185548 185549 . + . intron_id 17 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 185548 186199 . + . intron_id 17 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 186198 186199 . + . intron_id 16 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 186200 186316 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 186200 186316 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 186317 186318 . + . intron_id 18 ; splice_site "Gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 186317 189615 . + . intron_id 18 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 189614 189615 . + . intron_id 17 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 189616 189679 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 189616 189679 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 189680 189681 . + . intron_id 19 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 189680 190946 . + . intron_id 19 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 190945 190946 . + . intron_id 18 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 190947 190976 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 190947 190976 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 190977 190978 . + . intron_id 20 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 190977 197610 . + . intron_id 20 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 197609 197610 . + . intron_id 19 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 197611 197650 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 197611 197650 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 197651 197652 . + . intron_id 21 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 197651 201237 . + . intron_id 21 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 201236 201237 . + . intron_id 20 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 201238 201280 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 201238 201280 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 201281 201282 . + . intron_id 22 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 201281 204501 . + . intron_id 22 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 204500 204501 . + . intron_id 21 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 204502 204657 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 204502 204657 . + . insertions 3 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 7408 204657 127 + . alignment_id 1 ; Query SPP00000038_1.0 ; Align 7408 40 72 ; Align 13262 65 114 ; Align 19997 104 87 ; Align 34891 133 27 ; Align 37235 143 24 ; Align 62098 151 42 ; Align 86002 166 3 ; Align 95972 168 30 ; Align 109223 179 21 ; Align 122262 186 36 ; Align 123944 198 12 ; Align 139718 202 15 ; Align 146955 208 42 ; Align 149892 222 90 ; Align 159652 253 27 ; Align 172947 263 18 ; Align 185518 269 30 ; Align 186200 279 117 ; Align 189616 318 63 ; Align 190949 340 27 ; Align 197613 350 36 ; Align 201239 363 42 ; Align 204502 377 69 ; Align 204574 400 84 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 124 Query range: 186 -> 555 Target range: 4803 -> 206100 187 : LysProGlyGlyProGluAlaProGluThrGluAlaProGlnGlyIlePro >>>> : 204 :!!|||||||||||||||||| !! ! !! ||||||!:: ! !||| GluProGlyGlyProGluAlaGluAlaArgAlaAlaProArgLeuHisPro++ 4804 : GAGCCGGGCGGGCCCGAGGCCGAGGCGCGCGCTGCCCCCCGCTTGCACCCCgt..... : 4857 205 : Target Intron 1 >>>> GluLeuIleGluLeuLeuThrSerGlnIleSerIle : 215 13353 bp ! ! ||| ! !:!!|||! .!!!.!! ! ++IleCysProGluAsnAlaSerSerProPheLysThr 4858 : ....................agATCTGCCCGGAGAATGCCTCTTCACCCTTCAAAACC : 18241 216 : ProThrArgAspProSer >>>> Target Intron 2 >>>> GlyProPheLe : 225 |||.!!!:!||||||!!! 13903 bp |||||| !:! ProAlaLysAspProArg+- +-GlyProProVa 18242 : CCAGCCAAAGACCCTAGAgg.........................acGGACCTCCTGT : 32174 226 : uMetSerValAspHisCysPheSerIleLysGly{Gl} >>>> Target Intron : 237 ! !!!.!! ! ||| !|||:!:..!|||{!:} 2255 bp lAspProAlaValLeuCysThrSerValSerGly{Ar}++ 32175 : GGACCCTGCCGTGCTGTGCACCTCTGTGTCAGGA{CG}gt.................. : 32214 238 : 3 >>>> {n}GlyThrValMetThrGlyThrIleLeuSerGly{Se} >>>> Ta : 249 {!} |||||| !||||||:!! !:!!|||{||} ++{g}ValThrValSerCysGlyThrLeuThrAlaGly{Se}+- 32215 : .......ag{g}gtcACCGTCTCATGTGGCACTCTCACAGCAGGC{AG}gg....... : 34505 250 : rget Intron 4 >>>> {r}IleSerLeuGlyAspSerValGluIlePro{Al} : 260 2979 bp {|} !||||||!.!! !||| !! !:!:|||{::} ++{r}HisSerLeuAlaAlaSerPheLeuLeuPro{Se}+ 34506 : ..................ag{C}CATTCCCTGGCCGCCTCATTCTTGTTGCCA{AG}g : 37515 261 : >>>> Target Intron 5 >>>> {a}LeuLysValValLysLysValLysSer : 269 5516 bp {!} ! ! !! !!:! |||::::!! + ++{r}AlaValPheProArgProValArgAla 37516 : t.........................ag{C}GCAGTGTTTCCAAGGCCCGTCCGCGCG : 43056 270 : MetGlnMetPheHisMetProIleThrSerAlaMetGln{Gl} >>>> Target I : 283 ..!:!!.!.!.! !!:!:|||!!! !!!: {||} 1880 AlaSerValLeuArgAlaSerValThrThrPheIleThr{Gl}-+ 43057 : GCATCAGTGCTGCGCGCCTCTGTGACCACTTTCATCACC{GG}at............. : 43102 284 : ntron 6 >>>> {y}AspArgLeuGlyIleCysValThrGlnPhe{A} >>>> T : 294 bp {|} !!!!|||||| !|||:!! ! ! !{|} ++{y}ProSerLeuGlySerCysLeuGlyLeuAla{A}++ 43103 : ............ag{G}CCCAGTCTGGGTTCCTGCCTGGGCTTGGCT{G}gt...... : 45014 295 : arget Intron 7 >>>> {sp}ProLysLeuLeuGluArgGlyLeuVal{C} > : 304 6233 bp {||}|||::!||| !! |||.!.||| {.} ++{sp}ProArgLeuGlyValArgSerLeuArg{A}++ 45015 : ...................ag{AC}CCCCGGCTGGGTGTCAGGAGcctgcgg{g}gt. : 51277 305 : >>> Target Intron 8 >>>> {ys}AlaPro >>>> Target Intron 9 : 307 21331 bp {..}|||||| 14805 bp ++{la}AlaPro++ 51278 : ........................ag{CA}GCGCCGgt.................... : 72616 308 : >>>> GluSerLeuHisThrValHisAlaAla >>>> Target Intron 10 : 316 .!.!!! !||||||:!! !||| ! 16356 bp ++AsnThrGlyHisThrLeuIleAlaIle++ 72617 : .....agAACACTGGGCACACTCTGATTGCAATTgt...................... : 87448 317 : >>>> LeuIleSerValGluLysIleProTyrPheArgGlyProLeuGlnThrLysA : 333 !:!!.!!:!!! ! !|||||||||||||||||||||.!...! ! ++ThrLeuGlyLeuGlyProAlaProTyrPheArgGlyProLeuAspValLeuT 87449 : ....agACCCTCGGGCTCGGACCTGCACCCTACTTCAGGGGCCCGCTAGACGTCCTGT : 103853 334 : laLysPheHisIle >>>> Target Intron 11 >>>> ThrValGlyHisGl : 342 ! ! !:!! 884 bp !!.!|||...! yrProHisAsnGln+- ++ArgAlaGlyArgAl 103854 : ACCCGCACAACCAGga..........................agCGAGCGGGAAGAGC : 104764 343 : uThrValMet{Gl} >>>> Target Intron 12 >>>> {y}ArgLeuMetPh : 350 :!! !.!.{ !} 937 bp {!}!:!! !! aSerTyrPhe{Ar}++ ++{g}LysGlnSerPr 104765 : TTCCTACTTC{AG}gt..........................ag{G}AAACAAAGCCC : 105725 351 : ePheSerProAlaProAspAsnPheAspGlnGluProIleLeuAspSerPheAsnPhe : 369 !! .!! !!.!|||!!: .!.||| ! !||| ! ! !!!! !.. ! o***GlyGluGlyProGluProLeuAspThrGlyProGluGlyThrArgArgArgGly 105726 : CTGAGGGGAGGGACCAGAGCCACTGGACACCGGGCCAGAAGGGACCAGGAGGAGGGGC : 105782 370 : SerGlnGluTyrLeuPheGlnGluGlnTyrLeuSerLysAspLeuThrProAlaValT : 389 .!!:!!!!: !|||.!.! ! ||| !! !!!! !||| !.!!|||||||||| GlyGluAspProLeuLeuProProGlnAlaSerThrGlyAspAlaAlaProAlaValT 105783 : GGCGAGGACCCCCTGCTGCCACCCCAGGCCTCCACGGGGGACGCGGCGCCTGCGGTGA : 105842 390 : hr >>>> Target Intron 13 >>>> AspAsnAspGluAlaAspLysLysAl : 398 || 10392 bp ! :!! !!: !!!:! ::! hr-+ ++AlaAspProAspArgGluThrArgAr 105843 : CGct..........................agGCAGACCCGGACAGGGAGACTCGGAG : 116261 399 : aGlyGlnAlaThrGluGlyHisCysProArg >>>> Target Intron 14 >>> : 409 !|||:!!||| ! !|||! !||| !||| 958 bp gGlyGluAlaHisThrGlyProCysSerArg+- 116262 : AGGAGAGGCGCACACGGGACCCTGCAGCCGGga......................... : 116296 410 : > GlnGlnTrpAlaLeuValGluPheGluLysProValThrCysProArgLeuCysL : 427 .!. |||...::: ::: ...||| |||:::|||: ++AspGlyTrpGlyValCysValCysAlaArgValCysAlaCysValArgValCysV 116297 : .agGAtggatggggtgtgtgtgtgtgtgcacgcgtgtgtgcgtgtgtgcgtgtatgcg : 117306 428 : euValIleGlySerArgLeuAsp{Al} >>>> Target Intron 15 >>>> { : 435 :: ::: :::||| { } 14109 bp { alHisValCysAlaArgProCys{Ar}++ ++{ 117307 : tgcacgtgtgtgcgcgcccgtgc{ag}gt..........................ag{ : 131441 436 : a}AspIleHisThr{A} >>>> Target Intron 16 >>>> {sn}ThrCysA : 443 !}... !||||||{ } 14034 bp {!!}||| ! | g}SerAlaHisThr{T}++ ++{yr}ThrArgA 131442 : G}TCAGCACACACG{T}gt..........................ag{AT}ACAAGGA : 145497 444 : rgLeuAlaPheHisGlyIleLeuLeuHis >>>> Target Intron 17 >>>> : 453 ||||| ! :!!|||:::...|||||| 13642 bp rgLeuLeuThrAsnGlyLeuPheLeuHis+- + 145498 : GACTTCTGACAAATGgtttatttttacatga..........................a : 159167 454 : GlyLeuGlu{As} >>>> Target Intron 18 >>>> {p}ArgAsnTyrAl : 460 |||! !|||{! } 18341 bp { }|||..! !!. +GlyArgGlu{Gl}++ ++{y}ArgGlyProVa 159168 : gGGACGGGAG{GG}gt..........................ag{G}CGTGGCCCTGT : 177531 461 : aAspSerPheLeuProArgLeuLysValTyrLysLeuLysHisLysHisGlyLeuVal : 479 !..!..!||| !|||..! !::!! ! |||||| lSerGluPheThrProGluGlyArgGluLeuGlyLeuLysCysTrpGlyLysArgLys 177532 : CTCTGAGTTCACACCTGAGGGCCGGGAGCTGGGCCTGAAGTGctgggggaagagaaag : 177588 480 : GluArgAlaMetAsp{A} >>>> Target Intron 19 >>>> {sp}TyrSer : 487 :::||| !!!:{!} 4544 bp {!:} !||| LysArgAspTrpGlu{G}++ ++{lu}IleSer 177589 : aagagagactgGGAA{G}gt..........................ag{aa}atTTCC : 182156 488 : ValIleGlyArgSerLeu{P} >>>> Target Intron 20 >>>> {he}Lys : 495 :!!:!:..!!:!|||! !{ } 195 bp { }||| MetLeuSerGlnSerSer{A}++ ++{la}Lys 182157 : ATGTTGTCACAATCTTCT{G}gt..........................ag{CA}AAG : 182375 496 : LysGluThrAsnIleGlnLeuPheValGlyLeuLys >>>> Target Intron 2 : 508 |||||||||||| ! !:!!.!.:!!||||||||| 6223 bp LysGluThrAsnProValIleMetLeuGlyLeuLys++ 182376 : AAGGAAACCAACCCAGTGATAATGCTGGGTTTGAAAgt.................... : 182416 509 : 1 >>>> ValHisLeuSerThrGlyGluLeuGlyIleIleAspSerAlaPheGlyGl : 524 ||| !!!!.!!:!!||| ||| !:!!:!! ! ..!|||.!! ! -+ValValPheGlySerGlyPheLeuPheValLeuLysGluAlaIleProAl 182417 : ......tgGTGGTCTTTGGGTCTGGTTTCCTCTTCGTCCTAAAAGAGGCTATCCCCGC : 188685 525 : nSerGly >>>> Target Intron 22 >>>> LysPheLysIleHisIlePro : 533 ||| ! 14592 bp ! !!:! !!!.:!:||| aSerLys+- ++AlaGlyArgAlaGlnLeuPro 188686 : CAGCAAGgg..........................agGCAGGCAGAGCCCAACTGCCA : 203304 534 : Gly{Gl} >>>> Target Intron 23 >>>> {y}LeuSerProGluSerLys : 541 |||{||} 2728 bp {|} !!!!|||:!! !!::: Gly{Gl}+- ++{y}AlaThrProGlnProArg 203305 : GGC{GG}gg..........................ag{G}GCCACTCCCCAACCCCGT : 206056 542 : LysIleLeuThrProAlaLeuLysLysArgAlaArgAlaGly : 555 ::!:!!! !:!! !! ! ! :!!|||:!!||| !||| ArgValSerSerAlaGlnAlaAlaGluArgSerArgLeuGly 206057 : CGGGTCTCGTCTGCTCAGGCAGCCGAACGGTCTAGACTAGGG : 206100 vulgar: SPP00000038_1.0 186 555 . NIVO01001699.1:subseq(3461309,210250) 4803 206100 + 124 M 17 51 5 0 2 I 0 13349 3 0 2 M 18 54 5 0 2 I 0 13899 3 0 2 M 15 45 S 0 2 5 0 2 I 0 2251 3 0 2 S 1 1 M 11 33 S 0 2 5 0 2 I 0 2975 3 0 2 S 1 1 M 10 30 S 0 2 5 0 2 I 0 5512 3 0 2 S 1 1 M 22 66 S 0 2 5 0 2 I 0 1876 3 0 2 S 1 1 M 10 30 S 0 1 5 0 2 I 0 6229 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 21327 3 0 2 S 1 2 M 2 6 5 0 2 I 0 14801 3 0 2 M 9 27 5 0 2 I 0 16352 3 0 2 M 22 66 5 0 2 I 0 880 3 0 2 M 8 24 S 0 2 5 0 2 I 0 933 3 0 2 S 1 1 M 43 129 5 0 2 I 0 10388 3 0 2 M 19 57 5 0 2 I 0 954 3 0 2 M 26 78 S 0 2 5 0 2 I 0 14105 3 0 2 S 1 1 M 4 12 S 0 1 5 0 2 I 0 14030 3 0 2 S 1 2 M 12 36 5 0 2 I 0 13638 3 0 2 M 3 9 S 0 2 5 0 2 I 0 18337 3 0 2 S 1 1 M 28 84 S 0 1 5 0 2 I 0 4540 3 0 2 S 1 2 M 8 24 S 0 1 5 0 2 I 0 191 3 0 2 S 1 2 M 13 39 5 0 2 I 0 6219 3 0 2 M 19 57 5 0 2 I 0 14588 3 0 2 M 8 24 S 0 2 5 0 2 I 0 2724 3 0 2 S 1 1 M 20 60 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 4804 206100 124 + . gene_id 2 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 4804 4854 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 4804 4854 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 4855 4856 . + . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 4855 18207 . + . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 18206 18207 . + . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 18208 18261 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 18208 18261 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 18262 18263 . + . intron_id 2 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 18262 32164 . + . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 32163 32164 . + . intron_id 1 ; splice_site "AC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 32165 32211 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 32165 32211 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 32212 32213 . + . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 32212 34466 . + . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 34465 34466 . + . intron_id 2 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 34467 34502 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 34467 34502 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 34503 34504 . + . intron_id 4 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 34503 37481 . + . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 37480 37481 . + . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 37482 37514 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 37482 37514 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 37515 37516 . + . intron_id 5 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 37515 43030 . + . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 43029 43030 . + . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 43031 43099 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 43031 43099 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 43100 43101 . + . intron_id 6 ; splice_site "AT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 43100 44979 . + . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 44978 44979 . + . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 44980 45011 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 44980 45011 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 45012 45013 . + . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 45012 51244 . + . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 51243 51244 . + . intron_id 6 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 51245 51274 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 51245 51274 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 51275 51276 . + . intron_id 8 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 51275 72605 . + . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 72604 72605 . + . intron_id 7 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 72606 72613 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 72606 72613 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 72614 72615 . + . intron_id 9 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 72614 87418 . + . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 87417 87418 . + . intron_id 8 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 87419 87445 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 87419 87445 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 87446 87447 . + . intron_id 10 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 87446 103801 . + . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 103800 103801 . + . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 103802 103867 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 103802 103867 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 103868 103869 . + . intron_id 11 ; splice_site "GA" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 103868 104751 . + . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 104750 104751 . + . intron_id 10 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 104752 104777 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 104752 104777 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 104778 104779 . + . intron_id 12 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 104778 105714 . + . intron_id 12 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 105713 105714 . + . intron_id 11 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 105715 105844 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 105715 105844 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 105845 105846 . + . intron_id 13 ; splice_site "CT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 105845 116236 . + . intron_id 13 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 116235 116236 . + . intron_id 12 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 116237 116293 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 116237 116293 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 116294 116295 . + . intron_id 14 ; splice_site "GA" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 116294 117251 . + . intron_id 14 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 117250 117251 . + . intron_id 13 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 117252 117331 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 117252 117331 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 117332 117333 . + . intron_id 15 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 117332 131440 . + . intron_id 15 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 131439 131440 . + . intron_id 14 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 131441 131454 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 131441 131454 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 131455 131456 . + . intron_id 16 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 131455 145488 . + . intron_id 16 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 145487 145488 . + . intron_id 15 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 145489 145526 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 145489 145526 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 145527 145528 . + . intron_id 17 ; splice_site "ga" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 145527 159168 . + . intron_id 17 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 159167 159168 . + . intron_id 16 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 159169 159179 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 159169 159179 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 159180 159181 . + . intron_id 18 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 159180 177520 . + . intron_id 18 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 177519 177520 . + . intron_id 17 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 177521 177606 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 177521 177606 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 177607 177608 . + . intron_id 19 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 177607 182150 . + . intron_id 19 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 182149 182150 . + . intron_id 18 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 182151 182177 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 182151 182177 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 182178 182179 . + . intron_id 20 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 182178 182372 . + . intron_id 20 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 182371 182372 . + . intron_id 19 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 182373 182413 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 182373 182413 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 182414 182415 . + . intron_id 21 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 182414 188636 . + . intron_id 21 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 188635 188636 . + . intron_id 20 ; splice_site "TG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 188637 188693 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 188637 188693 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 188694 188695 . + . intron_id 22 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 188694 203285 . + . intron_id 22 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 203284 203285 . + . intron_id 21 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 203286 203311 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 203286 203311 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 203312 203313 . + . intron_id 23 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 203312 206039 . + . intron_id 23 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 206038 206039 . + . intron_id 22 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 206040 206100 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 206040 206100 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 4804 206100 124 + . alignment_id 2 ; Query SPP00000038_1.0 ; Align 4804 187 51 ; Align 18208 204 54 ; Align 32165 222 45 ; Align 34468 238 33 ; Align 37483 250 30 ; Align 43032 261 66 ; Align 44981 284 30 ; Align 51247 295 27 ; Align 72608 305 6 ; Align 87419 307 27 ; Align 103802 316 66 ; Align 104752 338 24 ; Align 105716 347 129 ; Align 116237 390 57 ; Align 117252 409 78 ; Align 131442 436 12 ; Align 145491 441 36 ; Align 159169 453 9 ; Align 177522 457 84 ; Align 182153 486 24 ; Align 182375 495 39 ; Align 188637 508 57 ; Align 203286 527 24 ; Align 206041 536 60 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 116 Query range: 2 -> 317 Target range: 22589 -> 192588 3 : GlyArgArgValAsnValAsnValGlyValLeuGlyHisIleAspSerGlyLysThr{ : 22 |||||| !!.!!.!:!!.!.!.!|||..!||| !!:!!:!:! ..!||| |||{ GlyArgAlaAlaThrLeuGluAlaGlyThrLeuArgAsnLeuGlyAspGlyProThr{ 22590 : GGGAGGGCGGCTACCCTGGAGGCTGGCACACTCCGGAACTTGGGGGATGGTCCCACA{ : 22647 23 : A} >>>> Target Intron 1 >>>> {la}LeuAlaArgAlaLeuSerThrTh : 30 } 38045 bp { !} !|||||||||! !..!.!! ! H}++ ++{is}GlyAlaArgAlaProGlnAlaPr 22648 : C}gt.........................ag{AC}GGAGCCAGAGCCCCACAGGCCCC : 60716 31 : rAla{Se} >>>> Target Intron 2 >>>> {r}ThrAlaAlaPheAspLys : 38 !!.!{.!} 10414 bp {!}|||::! ! |||::! oVal{Gl}++ ++{y}ThrSerLeuGlnAspArg 60717 : TGTC{GG}gt.........................ag{C}ACCAGCCTGCAGGATCGG : 71154 39 : GlnProGlnSerArgGluArgGlyIle{Th} >>>> Target Intron 3 >>>> : 48 !|||.....!|||..!|||||| {! } 1352 bp ThrProSerGlnArgArgArgGlyGln{Ar}+- 71155 : ACACCCAGCCAGCGGCGGCGAGGGCAG{AG}ga......................... : 71188 49 : {r}LeuAspLeuGlyPheSerCysPheSerValProLeuProAlaArgLeuArgSe : 66 {!}! !! :!!||| !!!! ! !|||||||||||| !|||!.!! !|||.! ++{g}ProValValGlyArgThrProAlaSerValProLeuIleAlaHisCysArgGl 71189 : ag{A}CCCGTGGTGGGGCGCACGCCTGCCTCAGTACCCCTGATCGCACACTGCCGCGG : 72590 67 : rSerLeuProGluPheGlnAla >>>> Target Intron 4 >>>> AlaProG : 76 ! !! !||| ! ! !! 11781 bp ||| !| yHisSerProProAlaAlaPro++ ++AlaGluG 72591 : CCACTCGCCCCCAGCAGCGCCGgt.........................agGCAGAGG : 84401 77 : luAlaGluProGluProGlyGluProLeuLeuGlnVal{T} >>>> Target Int : 89 |||||||||||...||||||! !||| ! ! !! !{ } 1560 b luAlaGluProArgProGlyValProThrThrAlaGly{G}++ 84402 : AGGCCGAGCCCCGCCCTGGCGTGCCCACGACGGCAGGG{G}gt............... : 84443 90 : ron 5 >>>> {hr}Leu{V} >>>> Target Intron 6 >>>> {al}Asp : 92 p { !} !{!} 10611 bp {.!}.!. ++{ly}Arg{A}++ ++{la}Gln 84444 : ..........ag{GA}AGA{G}gt.........................ag{CC}CAG : 96620 93 : CysProGlyHisAlaSerLeuIleArgThrIle{Il} >>>> Target Intron : 104 ||||||||||||!.! ! !:!:!:!! ! !{ } 4816 bp CysProGlyHisGlyHisThrLeuLysLysArg{Gl}++ 96621 : TGTCCGGGACACGGACACACACTGAAGAAGCGA{CA}gt................... : 96660 105 : 7 >>>> {e}GlyGlyAlaGlnIleIleAspLeuMetMet{Le} >>>> Target : 115 {!}||| ! !! :!:|||! ! ! {:!} 66 ++{n}GlyProTyrProAlaLeuAspProProThr{Va}++ 96661 : ......ag{A}GGCCCCTACCCTGCGCTGGACCCGCCAACA{GT}gt........... : 101509 116 : Intron 8 >>>> {u}ValIleAspValThrLysGlyMetGlnThrGlnSerAla : 128 64 bp {!}! !:!! !!.! ! ||||||!::|||! !||| !! ++{l}GlyLeuThrAlaGlyProGlyMetArgThrLeuSerPro 101510 : ..............ag{C}GGCCTCACCGCGGGGCCCGGGATGCGCACGCTGTCCCCA : 108208 129 : GluCysLeuValIleGlyGlnIleAlaCysGlnLysLeuValValValLeuAsnLysI : 148 ..! !:!!||| !.!.|||:!! .....!|||:!! !..! ! !:! ArgMetGlyLeuIleGlnAspIleSerGluSerSerLeuLeuGlnThrThrLeuArgG 108209 : CGAATGGGACTCATCCAGGACATTTCAGAGTCTTCACTGTTACAAACAACACTGAGAG : 108268 149 : leAspLeuLeuProGluGlyLysArgGlnAlaAlaIleAspLysMetThrLysLysMe : 167 !! ! !! !! !..! !! ! !!.!|||.!! !:! ! !..!|||! lyAlaCysArgArgArgCysLeuAspLeuGlyAlaPheThrArgCysMetSerLysTh 108269 : GAGCATGCCGCCGGAGGTGCCTTGATTTGGGCGCGTTCACGAGGTGTATGTCAAAGAC : 108325 168 : tGlnLysThrLeuGluAsnThr{Ly} >>>> Target Intron 9 >>>> {s} : 175 !:!:!!||| !.!. ..!{||} 19840 bp {|} rArgGlnThrLysAsnProVal{Ly}++ -+{s} 108326 : TCGACAAACCAAAAACCCAGTC{AA}gt.........................gg{G} : 128191 176 : PheArgGlyAlaProIle >>>> Target Intron 10 >>>> IleProValA : 185 !:!|||||| !! !:!: 7761 bp ||| !| TyrArgGlyProGluVal++ ++AlaProSerA 128192 : TACCGAGGGCCCGAGGTGgt..........................agGCGCCTTCTG : 135980 186 : laAlaLysProGlyGlyProGluAlaProGluThr >>>> Target Intron 11 : 197 |||||:!! !||||||||| ||||||:!!||| 1206 bp laAlaGluAspGlyGlyProProAlaProGlnThr+- 135981 : CGGCTGAGGACGGAGGGCCCCCCGCCCCGCAGACGgc..................... : 136018 198 : >>>> GluAlaProGlnGlyIleProGluLeuIleGluLeuLeuThr{S} >>>> : 211 !!:::!|||.....!! !|||..! ! ! ||| !|||{.} -+AspSerProSerSerThrProArgArgGlyAlaLeuThrThr{G}++ 136019 : .....ggGACAGCCCCTCCTCTACACCCAGGAGAGGGGCCCTGACAACA{G}gt.... : 137267 212 : Target Intron 12 >>>> {er}GlnIleSerIleProThrArgAspProSer : 221 12819 bp {.!}...::: ||| :::||| ++{lu}AspLeuProSerProGlyThrGluProArg 137268 : ......................ag{ag}gatcttcccagcccagggactgaacccagg : 150113 222 : GlyProPheLeuMetSerValAspHisCys{P} >>>> Target Intron 13 > : 232 ...||| |||... ... { } 165 bp SerProValLeuGlnValAspSerSerSer{V}-+ 150114 : tctcctgtgttgcaggtggattcttcatca{g}ct....................... : 150149 233 : >>> {he}SerIleLysGlyGlnGlyThrValMetThrGlyThrIleLeuSerGlyS : 249 {!!}..! !:!! !!! ! !||||||:!!.!!..! !:!:||||||.!!| ++{al}GlnArgGlnTrpProThrThrValLeuAlaSerTrpLeuLeuSerSerS 150150 : ...ag{TT}CAGCGTCAATGGCCGACTACAGTCCTGGCATCCTGGCTGCTGTCCAGCT : 150362 250 : er{I} >>>> Target Intron 14 >>>> {le}SerLeuGlyAspSerValG : 257 ||{:} 10522 bp {!:}.!!||||||! .!! !| er{V}++ ++{al}GlyLeuGlyValGlyProG 150363 : CA{G}gt..........................ag{TG}GGCCTCGGGGTGGGGCCTG : 160908 258 : luIle{P} >>>> Target Intron 15 >>>> {ro}AlaLeuLysValValL : 265 || !{|} 17450 bp {||}|||:!! :!!:!! luPro{P}++ ++{ro}AlaValValIleLeuA 160909 : AGCCC{C}gt..........................ag{CA}GCTGTGGTTATTTTAG : 178382 266 : ysLysValLysSerMetGlnMetPhe >>>> Target Intron 16 >>>> Hi : 274 !||||||! ||| ! !!:!:: 3555 bp || laLysValIleSer***PheIleTrp++ ++Hi 178383 : CAAAAGTCATTTCGTAGTTTATATGGgt..........................agCA : 181964 275 : sMetProIleThrSerAlaMetGlnGly{As} >>>> Target Intron 17 >> : 284 |! !! !:!!!.! !|||||||||{ } 10493 bp sArgAlaAlaSerLysGlnMetGlnGly{**}++ 181965 : CAGAGCAGCTTCCAAACAAATGCAGGGC{TG}gt........................ : 181998 285 : >> {p}ArgLeuGlyIleCysValThrGlnPheAspProLysLeuLeuGluArgGly : 301 { }|||:!! !!:!! ! !||| |||..! !! !|||! !||||||..! ++{*}ArgMetCysValProGluThrIlePheSerAsnThrLeuSerGluArgAsn 181999 : ..ag{A}AGGATGTGTGTTCCAGAAACCATTTTCTCTAATACGTTGTCTGAAAGAAAT : 192538 302 : LeuValCysAlaProGluSerLeuHisThrValHisAlaAlaLeuIle : 317 !!!||| ! ! !:!!||||||:!!||| !!! !:!!|||:!! PheValProLysSerGlnSerLeuAsnThrPheProGlnSerLeuVal 192539 : TTTGTGCCTAAGAGTCAGAGCTTGAACACATTTCCACAGTCTTTGGTC : 192588 vulgar: SPP00000038_1.0 2 317 . NIVO01001699.1:subseq(3461309,210250) 22589 192588 + 116 M 19 57 S 0 1 5 0 2 I 0 38041 3 0 2 S 1 2 M 9 27 S 0 2 5 0 2 I 0 10410 3 0 2 S 1 1 M 15 45 S 0 2 5 0 2 I 0 1348 3 0 2 S 1 1 M 25 75 5 0 2 I 0 11777 3 0 2 M 15 45 S 0 1 5 0 2 I 0 1556 3 0 2 S 1 2 M 1 3 S 0 1 5 0 2 I 0 10607 3 0 2 S 1 2 M 12 36 S 0 2 5 0 2 I 0 4812 3 0 2 S 1 1 M 10 30 S 0 2 5 0 2 I 0 6660 3 0 2 S 1 1 M 59 177 S 0 2 5 0 2 I 0 19836 3 0 2 S 1 1 M 6 18 5 0 2 I 0 7757 3 0 2 M 15 45 5 0 2 I 0 1202 3 0 2 M 14 42 S 0 1 5 0 2 I 0 12815 3 0 2 S 1 2 M 20 60 S 0 1 5 0 2 I 0 161 3 0 2 S 1 2 M 17 51 S 0 1 5 0 2 I 0 10518 3 0 2 S 1 2 M 8 24 S 0 1 5 0 2 I 0 17446 3 0 2 S 1 2 M 14 42 5 0 2 I 0 3551 3 0 2 M 10 30 S 0 2 5 0 2 I 0 10489 3 0 2 S 1 1 M 33 99 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 22590 192588 116 + . gene_id 3 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 22590 22647 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 22590 22647 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 22648 22649 . + . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 22648 60692 . + . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 60691 60692 . + . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 60693 60723 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 60693 60723 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 60724 60725 . + . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 60724 71137 . + . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 71136 71137 . + . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 71138 71185 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 71138 71185 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 71186 71187 . + . intron_id 3 ; splice_site "GA" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 71186 72537 . + . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 72536 72537 . + . intron_id 2 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 72538 72613 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 72538 72613 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 72614 72615 . + . intron_id 4 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 72614 84394 . + . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 84393 84394 . + . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 84395 84440 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 84395 84440 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 84441 84442 . + . intron_id 5 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 84441 86000 . + . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 85999 86000 . + . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 86001 86006 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 86001 86006 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 86007 86008 . + . intron_id 6 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 86007 96617 . + . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 96616 96617 . + . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 96618 96657 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 96618 96657 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 96658 96659 . + . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 96658 101473 . + . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 101472 101473 . + . intron_id 6 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 101474 101506 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 101474 101506 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 101507 101508 . + . intron_id 8 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 101507 108170 . + . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 108169 108170 . + . intron_id 7 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 108171 108350 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 108171 108350 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 108351 108352 . + . intron_id 9 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 108351 128190 . + . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 128189 128190 . + . intron_id 8 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 128191 128209 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 128191 128209 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 128210 128211 . + . intron_id 10 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 128210 135970 . + . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 135969 135970 . + . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 135971 136015 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 135971 136015 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 136016 136017 . + . intron_id 11 ; splice_site "GC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 136016 137221 . + . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 137220 137221 . + . intron_id 10 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 137222 137264 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 137222 137264 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 137265 137266 . + . intron_id 12 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 137265 150083 . + . intron_id 12 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 150082 150083 . + . intron_id 11 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 150084 150146 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 150084 150146 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 150147 150148 . + . intron_id 13 ; splice_site "ct" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 150147 150311 . + . intron_id 13 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 150310 150311 . + . intron_id 12 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 150312 150365 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 150312 150365 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 150366 150367 . + . intron_id 14 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 150366 160887 . + . intron_id 14 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 160886 160887 . + . intron_id 13 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 160888 160914 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 160888 160914 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 160915 160916 . + . intron_id 15 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 160915 178364 . + . intron_id 15 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 178363 178364 . + . intron_id 14 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 178365 178408 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 178365 178408 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 178409 178410 . + . intron_id 16 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 178409 181963 . + . intron_id 16 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 181962 181963 . + . intron_id 15 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 181964 181995 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 181964 181995 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 181996 181997 . + . intron_id 17 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 181996 192488 . + . intron_id 17 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 192487 192488 . + . intron_id 16 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 192489 192588 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 192489 192588 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 22590 192588 116 + . alignment_id 3 ; Query SPP00000038_1.0 ; Align 22590 3 57 ; Align 60695 23 27 ; Align 71139 33 45 ; Align 72539 49 75 ; Align 84395 74 45 ; Align 86003 90 3 ; Align 96620 92 36 ; Align 101475 105 30 ; Align 108172 116 177 ; Align 128192 176 18 ; Align 135971 182 45 ; Align 137222 197 42 ; Align 150086 212 60 ; Align 150314 233 51 ; Align 160890 251 24 ; Align 178367 260 42 ; Align 181964 274 30 ; Align 192490 285 99 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 110 Query range: 183 -> 569 Target range: 3420 -> 188042 184 : ValAlaAlaLysProGlyGlyProGluAlaProGluThrGluAlaProGlnGlyIleP : 203 :!! !!|||:!!|||||| ! !! !..!||| !!:!..!!.! !!:!|||:!! MetProAlaGluProGlyLeuAlaTrpCysProProSerArgGlyAspArgGlyLeuS 3421 : ATGCCGGCGGAGCCCGGCCTGGCCTGGTGCCCCCCGAGCCGAGGGGACCGAGGGCTTT : 3478 204 : roGluLeuIleGluLeuLeuThrSerGlnIleSerIleProThr{A} >>>> Targ : 218 !!...|||:!!..!||||||! !|||..!.!! !! ! !:!!{ } erSerLeuLeuArgLeuLeuLysSerSerPheProGlyGluSer{A}++ 3479 : CCTCCCTCCTCAGATTATTAAAAAGTTCATTTCCTGGCGAATCG{G}gt......... : 3526 219 : et Intron 1 >>>> {rg}AspProSerGlyProPheLeuMet{Se} >>>> T : 227 3363 bp { !}!!: !..!||||||.!!|||:!:{||} ++{la}GluGluGlnGlyProLeuLeuLeu{Se}++ 3527 : ................ag{CA}GAGGAGCAAGGCCCGCTCCTGCTC{AG}gt...... : 6917 228 : arget Intron 2 >>>> {r}ValAspHisCysPheSerIleLysGlyGln{G} : 238 6885 bp {|} !|||||| ! .!...! ! !|||..!{|} ++{r}ProAspHisArgLeuGluGlyAlaGlySer{G}+ 6918 : ...................ag{C}CCAGACCACAGGCTGGAGGGCGCGGGCTCA{G}g : 13832 239 : >>>> Target Intron 3 >>>> {ly}Thr{V} >>>> Target Intron : 240 5421 bp {||}.!!{|} 1512 bp + ++{ly}Ala{V}+- 13833 : t.........................ag{GA}GCA{G}gc.................. : 19261 241 : 4 >>>> {al}MetThrGlyThrIleLeuSerGlySerIleSerLeuGlyAspSer : 255 {||}... ......|||......||||||||| ... ++{al}GlnLysHisProPhePheSerAlaGlnIleSerLeu***Ser*** 19262 : .......ag{tt}caaaagcatccgttctttagcgctcaaatttctttatagtcttaa : 20815 256 : ValGluIleProAlaLeuLysValValLysLysValLysSerMetGlnMetPheHisM : 275 :::... ||| ::: ... ||| ::: ::: : LeuSerHisProTyrMetThrThrGlyLysThrIleAlaLeuThrArgArgThrPheV 20816 : ctctcgcatccatacatgaccactggaaaaaccatagccttgactagacggacctttg : 20875 276 : etProIleThrSerAlaMetGlnGlyAspArgLeuGlyIleCysValThrGlnPheAs : 294 :: ...:::...::: ::: |||... |||||| ||| alGly***ValThrCysLeuLeuPheAsnMetLeuSerArgLeuValThrAlaPheLe 20876 : ttggctaagtgacgtgtctgctttttaacatgctgtctaggttggtcacagcttttct : 20932 295 : pPro{Ly} >>>> Target Intron 5 >>>> {s}LeuLeuGluArgGlyLeu : 302 |||{!.} 15816 bp {.}||||||!!:! ! !! ! uPro{Se}+- ++{r}LeuLeuAspThrGlnGln 20933 : tcca{ag}ga.........................ag{C}CTTCTGGACACACAGCAG : 36772 303 : ValCysAlaProGluSerLeuHisThrValHisAlaAlaLeuIleSer{V} >>>> : 319 !|||||| !! !!! ! ! !:!! !..!:!!|||:!:..!{|} SerCysAlaValAlaThrAspSerPheIleSerCysSerLeuValGlu{V}++ 36773 : TCCTGTGCGGTGGCCACTGACTCTTTCATTTCCTGCTCCCTCGTGGAG{G}gt..... : 36826 320 : Target Intron 6 >>>> {al}GluLysIleProTyrPheArgGlyProLeuGl : 330 7612 bp {||}..! !! !!:: !!!!..! !|||! ++{al}ArgGlyProArgTrpAlaSerSerArgLeuLe 36827 : ....................ag{TG}CGGGGCCCACGGTGGGCCAGCTCCAGGCTGCT : 44468 331 : nThrLysAlaLysPheHisIleThrValGlyHisGluThrValMet{G} >>>> Ta : 346 ||| !!.. !||||||||||||:!!.!!!.!..!{!} uThrProArgSerAlaGlyProThrValGlyHisGlnAlaAlaGln{V}++ 44469 : CACTCCCCGGAGTGCGGGGCCCACGGTGGGCCACCAGGCAGCGCAG{G}gt....... : 44519 347 : rget Intron 7 >>>> {ly}ArgLeuMetPhePheSerProAlaPro{A} >> : 356 1470 bp { !}|||||| !.!. !!|||||||||{|} ++{al}ArgLeuTrpLeuGluProProAlaPro{A}+- 44520 : ..................ag{TC}CGTCTCTGGCTGGAGCCCCCCGCGCCC{G}gc.. : 46019 357 : >> Target Intron 8 >>>> {sp}AsnPheAspGlnGluProIleLeuAsp{S : 366 681 bp {||}....!.|||......|||! |||.!.{: ++{sp}GlyMetAspSerSerProArgLeuGln{A 46020 : .......................ag{AT}GGGATGGACAGCTCCCCGAGGCTGCAG{G : 46727 367 : } >>>> Target Intron 9 >>>> {er}Phe >>>> Target Intron : 368 } 9381 bp {!!}!:: 8373 bp }++ ++{la}Trp++ 46728 : }gt.........................ag{CC}TGGgt................... : 56116 369 : 10 >>>> AsnPheSerGlnGlu >>>> Target Intron 11 >>>> TyrL : 374 |||!:: ! :!! 5453 bp !:: ++AsnTrpValValGln++ ++TrpS 56117 : .......agAACTGGGTAGTCCAGgt..........................agTGGA : 69958 375 : euPheGlnGluGlnTyrLeuSerLysAspLeuThrProAlaValThrAsp >>>> T : 391 !.!.:!!.!.|||! !|||! !||||||! ! !||| !! ! !!!: erLeuLysAsnGlnCysLeuPheLysAspHis***ProProAsnGlnGlu++ 69959 : GCCTGAAAAACCAGTGTTTGTTTAAAGACCATTAACCACCTAACCAGGAGgt...... : 70011 392 : arget Intron 12 >>>> AsnAspGluAlaAspLysLysAlaGlyGlnAlaThr : 402 14386 bp !!:||||||!!: ::: !!||| ! !!||| ++AlaGluGluAlaGluProArgProGlyValProThr 70012 : ....................agGCAGAGGAGGCCGAGCCCCGCCCTGGCGTGCCCACG : 84428 403 : GluGlyHis{C} >>>> Target Intron 13 >>>> {ys}ProArgGlnGln : 410 !!.! {.} 14513 bp {.!}|||||| ||| ThrAlaGly{A}++ ++{la}ProArgAlaGln 84429 : ACGGCAGGG{G}gt..........................ag{CC}CCCAGAGCCCAG : 98965 411 : TrpAla{Le} >>>> Target Intron 14 >>>> {u}ValGluPheGluLys : 418 ! |||{ } 691 bp {!} !! ! ! GlyAla{Gl}++ ++{y}ArgValGlyAlaTrp 98966 : GGTGCC{GG}gt..........................ag{C}AGGGTCGGGGCCTGG : 99680 419 : ProValThrCysProArg >>>> Target Intron 15 >>>> LeuCysLeuV : 428 ||| !|||||||||!:! 16026 bp !|||!!!: ProProThrCysProGln++ ++LysCysPheL 99681 : CCGCCCACCTGCCCGCAGgt..........................agAAATGTTTCC : 115736 429 : alIleGlySerArgLeuAspAlaAspIleHisThrAsnThrCysArgLeuAlaPheHi : 447 !!:!! ! !!!:!! ! ...... ||| !! !|||!!.|| euLeuMetArgLysTrpProValSerProLeuLeuProPheCysPheCysAlaLeuHi 115737 : TTCTTATGCGGAAATGGCCagtctctcctcttctcccctttTGTTTCTGCGCTTTGCA : 115793 448 : sGlyIleLeu >>>> Target Intron 16 >>>> LeuHisGlyLeuGluAsp : 456 |! ! !! 16916 bp ||| !||| !! ! sValAla***++ ++LeuCysGlyThrAlaAla 115794 : TGTTGCCTaggt..........................agCTCTGTGGCACGGCTGCG : 132736 457 : ArgAsnTyrAlaAspSerPheLeuProArgLeuLysValTyrLysLeuLysHisLysH : 476 ||| ! ||| !!|||||||||! !!!!! ! !:!! ::!!!!:!!! !! ! ArgProValAlaHisSerPheLeuHisSerSerValLeuLeuArgPheGlnProThrV 132737 : AGGCCTGTGGCCCACTCATTTCTGCACAGCTCAGTGCTGCTACGGTTCCAACCCACAG : 132796 477 : isGlyLeuVal >>>> Target Intron 17 >>>> GluArgAlaMetAspAs : 485 !..!! !! ! 4437 bp ||||||!.! |||:! alSerProGlu++ ++GluArgGlyProAspAs 132797 : TCTCCCCCGAGgt..........................agGAGAGGGGCCCTGACAA : 137260 486 : p{Ty} >>>> Target Intron 18 >>>> {r}SerValIleGlyArgSer{L : 493 !{ } 2450 bp {!}||| !!! ..! !! !!{ n{Se}++ ++{r}SerPheThrAsnTrpPro{G 137261 : C{AG}gt..........................ag{T}AGTTTTACGAATTGGCCA{G : 139734 494 : } >>>> Target Intron 19 >>>> {eu}PheLysLysGluThrAsnIleGl : 501 } 9280 bp { !} ||||||::: ::: || }++ ++{ly}LysLysLysLysAspSerLysGl 139735 : }gt..........................ag{ga}aaaaaaaaaaaagacagcaagcA : 149038 502 : nLeuPheValGlyLeu >>>> Target Intron 20 >>>> LysValHisLeu : 510 ||||||| !||| ! 4086 bp ! ||| !! ! nLeuPheSerGlyGly++ ++ThrValPheTrp 149039 : GCTATTTTCTGGAGGGgt..........................agACTGTATTTTGG : 153151 511 : SerThrGlyGluLeuGlyIleIleAspSerAlaPheGlyGln >>>> Target In : 525 !!!.!!|||.!. !|||:!!! ! !!! !!.! ..!!:! 7977 ArgAlaGlyAsnThrGlyValThrHisMetGlyGlySerArg++ 153152 : AGAGCAGGGAACACCGGGGTCACACACATGGGAGGGTCTCGGgt.............. : 153198 526 : tron 21 >>>> SerGlyLysPheLysIleHisIleProGlyGlyLeuSerProGl : 539 bp ...... ||| :!! !! ||||||!.!||| !|||! ++GlySerHisPheAlaLeuAspGlnProGlyAlaLeuValProAl 153199 : ............agggaagccactttGCTTTAGACCAGCCTGGTGCTCTGGTGCCCGC : 161215 540 : uSerLysLys >>>> Target Intron 22 >>>> IleLeuThrProAlaLeu : 548 !! ! 26735 bp ! !|||||| ! !||| aProValLeu++ ++AsnLeuThrLeuLysLeu 161216 : CCCTGTCCTGgt..........................agAATTTGACCTTGAAGCTG : 187977 549 : LysLysArgAlaArgAlaGlyArgGlyGluAlaThrArgGlnGluGluSerAlaGluA : 568 |||!..! !:!!! !..! !|||||| !..!||||||::!..!..!|||:!!..!! LysSerThrSerProCysProArgGlyThrCysThrArgArgArgArgSerSerArgT 187978 : AAGAGTACGTCCCCCTGCCCAAGGGGGACGTGCACAAGAAGAAGGAGATCATCCAGGA : 188037 569 : rgSer : 569 !||| hrSer 188038 : CGTCA : 188042 vulgar: SPP00000038_1.0 183 569 . NIVO01001699.1:subseq(3461309,210250) 3420 188042 + 110 M 34 102 S 0 1 5 0 2 I 0 3359 3 0 2 S 1 2 M 8 24 S 0 2 5 0 2 I 0 6881 3 0 2 S 1 1 M 10 30 S 0 1 5 0 2 I 0 5417 3 0 2 S 1 2 M 1 3 S 0 1 5 0 2 I 0 1508 3 0 2 S 1 2 M 55 165 S 0 2 5 0 2 I 0 15812 3 0 2 S 1 1 M 22 66 S 0 1 5 0 2 I 0 7608 3 0 2 S 1 2 M 26 78 S 0 1 5 0 2 I 0 1466 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 677 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 9377 3 0 2 S 1 2 M 1 3 5 0 2 I 0 8369 3 0 2 M 5 15 5 0 2 I 0 5449 3 0 2 M 18 54 5 0 2 I 0 14382 3 0 2 M 15 45 S 0 1 5 0 2 I 0 14509 3 0 2 S 1 2 M 6 18 S 0 2 5 0 2 I 0 687 3 0 2 S 1 1 M 11 33 5 0 2 I 0 16022 3 0 2 M 26 78 5 0 2 I 0 16912 3 0 2 M 29 87 5 0 2 I 0 4433 3 0 2 M 6 18 S 0 2 5 0 2 I 0 2446 3 0 2 S 1 1 M 6 18 S 0 1 5 0 2 I 0 9276 3 0 2 S 1 2 M 13 39 5 0 2 I 0 4082 3 0 2 M 18 54 5 0 2 I 0 7973 3 0 2 M 18 54 5 0 2 I 0 26731 3 0 2 M 27 81 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 3421 188042 110 + . gene_id 4 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 3421 3523 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 3421 3523 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 3524 3525 . + . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 3524 6886 . + . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 6885 6886 . + . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 6887 6914 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 6887 6914 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 6915 6916 . + . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 6915 13799 . + . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 13798 13799 . + . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 13800 13831 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 13800 13831 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 13832 13833 . + . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 13832 19252 . + . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 19251 19252 . + . intron_id 2 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 19253 19258 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 19253 19258 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 19259 19260 . + . intron_id 4 ; splice_site "GC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 19259 20770 . + . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 20769 20770 . + . intron_id 3 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 20771 20939 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 20771 20939 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 20940 20941 . + . intron_id 5 ; splice_site "ga" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 20940 36755 . + . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 36754 36755 . + . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 36756 36823 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 36756 36823 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 36824 36825 . + . intron_id 6 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 36824 44435 . + . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 44434 44435 . + . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 44436 44516 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 44436 44516 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 44517 44518 . + . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 44517 45986 . + . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 45985 45986 . + . intron_id 6 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 45987 46016 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 45987 46016 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 46017 46018 . + . intron_id 8 ; splice_site "GC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 46017 46697 . + . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 46696 46697 . + . intron_id 7 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 46698 46727 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 46698 46727 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 46728 46729 . + . intron_id 9 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 46728 56108 . + . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 56107 56108 . + . intron_id 8 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 56109 56113 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 56109 56113 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 56114 56115 . + . intron_id 10 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 56114 64486 . + . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 64485 64486 . + . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 64487 64501 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 64487 64501 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 64502 64503 . + . intron_id 11 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 64502 69954 . + . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 69953 69954 . + . intron_id 10 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 69955 70008 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 69955 70008 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 70009 70010 . + . intron_id 12 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 70009 84394 . + . intron_id 12 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 84393 84394 . + . intron_id 11 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 84395 84440 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 84395 84440 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 84441 84442 . + . intron_id 13 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 84441 98953 . + . intron_id 13 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 98952 98953 . + . intron_id 12 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 98954 98975 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 98954 98975 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 98976 98977 . + . intron_id 14 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 98976 99666 . + . intron_id 14 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 99665 99666 . + . intron_id 13 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 99667 99700 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 99667 99700 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 99701 99702 . + . intron_id 15 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 99701 115726 . + . intron_id 15 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 115725 115726 . + . intron_id 14 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 115727 115804 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 115727 115804 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 115805 115806 . + . intron_id 16 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 115805 132720 . + . intron_id 16 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 132719 132720 . + . intron_id 15 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 132721 132807 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 132721 132807 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 132808 132809 . + . intron_id 17 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 132808 137244 . + . intron_id 17 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 137243 137244 . + . intron_id 16 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 137245 137264 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 137245 137264 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 137265 137266 . + . intron_id 18 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 137265 139714 . + . intron_id 18 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 139713 139714 . + . intron_id 17 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 139715 139734 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 139715 139734 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 139735 139736 . + . intron_id 19 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 139735 149014 . + . intron_id 19 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 149013 149014 . + . intron_id 18 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 149015 149055 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 149015 149055 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 149056 149057 . + . intron_id 20 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 149056 153141 . + . intron_id 20 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 153140 153141 . + . intron_id 19 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 153142 153195 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 153142 153195 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 153196 153197 . + . intron_id 21 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 153196 161172 . + . intron_id 21 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 161171 161172 . + . intron_id 20 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 161173 161226 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 161173 161226 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 161227 161228 . + . intron_id 22 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 161227 187961 . + . intron_id 22 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 187960 187961 . + . intron_id 21 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 187962 188042 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 187962 188042 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 3421 188042 110 + . alignment_id 4 ; Query SPP00000038_1.0 ; Align 3421 184 102 ; Align 6889 219 24 ; Align 13801 228 30 ; Align 19255 239 3 ; Align 20773 241 165 ; Align 36757 297 66 ; Align 44438 320 78 ; Align 45989 347 27 ; Align 46700 357 27 ; Align 56111 367 3 ; Align 64487 368 15 ; Align 69955 373 54 ; Align 84395 391 45 ; Align 98956 407 18 ; Align 99668 414 33 ; Align 115727 425 78 ; Align 132721 451 87 ; Align 137245 480 18 ; Align 139716 487 18 ; Align 149017 494 39 ; Align 153142 507 54 ; Align 161173 525 54 ; Align 187962 543 81 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 105 Query range: 119 -> 425 Target range: 570 -> 198190 120 : ThrLysGlyMetGlnThrGlnSerAlaGlu >>>> Target Intron 1 >>>> : 130 |||:!!|||!!: !!!.!!::||||||||| 4627 bp ThrGlnGlyIle***AsnArgSerAlaGlu++ + 571 : ACCCAGGGCATTTAGAACCGTTCCGCAGAGgt.........................a : 5226 131 : CysLeuValIleGlyGln >>>> Target Intron 2 >>>> IleAlaCysG : 139 |||||| !! !|||..! 2350 bp :!!.!!|||: +CysLeuCysThrGlyMet++ ++ValThrCysA 5227 : gTGTTTATGCACAGGGATGgt.........................agGTCACTTGTA : 7605 140 : lnLysLeuValValValLeuAsnLysIleAspLeuLeuPro >>>> Target Int : 153 :!! !!!!!.! !! !! !!..!.. ! ||||||||| 1848 b rgThrPheAlaProGluSerArgSerHisThrLeuLeuPro++ 7606 : GAACATTCGCTCCAGAGTCCAGAAGCCACACGCTCCTGCCCgt............... : 7649 154 : ron 3 >>>> GluGlyLysArgGln{A} >>>> Target Intron 4 >>>> : 158 p |||..! ! !! !{!} 5087 bp ++GluSerGlyAlaPro{G}++ + 7650 : ..........agGAGTCCGGGGCTCCG{G}gt.........................a : 14596 159 : {la}AlaIleAspLysMetThrLysLysMetGlnLysThrLeuGluAsnThrLysPh : 176 {.!}||| |||!:! .!!:!! :!!!.. !|||!!: ! ! !.! +{ly}AlaArgAspArgAlaAlaGluGlyAlaGluSerArgLeuAspAlaGlyProLe 14597 : g{GG}GCCCGGGACAGGGCTGCGGAAGGTGCCGAGAGCCGGCTGGATGCTGGGCCACT : 14651 177 : eArgGlyAlaProIleIleProValAlaAlaLys{Pr} >>>> Target Intron : 188 . !|||||| !! ! !|||||| ! !! {! } 8036 bp uAlaGlyAlaSerGlnThrProValAsnGlnThr{Ar}++ 14652 : GGCAGGCGCTTCTCAGACACCCGTGAACCAGACC{CG}gt.................. : 14691 189 : 5 >>>> {o}GlyGlyProGlu{A} >>>> Target Intron 6 >>>> {l : 193 {!}|||||| |||{!} 2443 bp {. ++{g}GlyGlyGluGlu{G}++ ++{l 14692 : .......ag{g}ggtggggaggag{g}gt.........................ag{G : 25182 194 : a}ProGluThrGluAlaProGlnGlyIleProGlu{Le} >>>> Target Intro : 205 !}||| ! ! !||||||||| !||| !{ } 15395 bp y}ProCysArgLeuGlnProGlnGlyAlaProPro{Gl}++ 25183 : C}CCCTGCAGACTCCAGCCACAAGGGGCTCCTCCA{GG}gt................. : 25221 206 : n 7 >>>> {u}IleGluLeuLeuThrSerGlnIleSerIleProThrArgAspPro : 220 {!}!!:..!! ! ! |||::: :::||| !||||||||| ++{y}MetArgGlnGlyGlyProGlnLeuCysLeuProGlyArgAspPro 25222 : ........ag{C}ATGAGGCAGGGAGggccccagctctgcctgcctGGCCGCGACCCC : 40657 221 : SerGlyProPheLeuMetSerVal >>>> Target Intron 8 >>>> AspHi : 230 !||||||! !:!!||| ! 20852 bp ||| HisGlyProSerAlaValSerArg++ +-AspPh 40658 : CACGGGCCCTCGGCTGTGAGCAGGgt.........................aagACTT : 61539 231 : sCysPheSer{Il} >>>> Target Intron 9 >>>> {e}LysGlyGlnGly : 238 ! !|||!!!{ } 3321 bp { }!:!||||||||| eProPheThr{Tr}++ ++{p}ArgGlyGlnGly 61540 : CCCTTTCACG{TG}gt.........................ag{G}AGGGGCCAGGGC : 64884 239 : ThrValMetThrGlyThrIleLeuSerGlySerIleSer{L} >>>> Target In : 252 |||:!! ||| !! !! !|||.!!||| !.!!{|} 7819 ThrLeuCysThrTrpHisThrAlaSerSerSerAspGly{L}++ 64885 : ACCCTCTGCACCTGGCACACGGCCTCCAGCAGTGATGGC{C}gt.............. : 64929 253 : tron 10 >>>> {eu}GlyAspSerValGluIleProAlaLeuLysValValLysL : 266 bp {||}! !! !..!!.!:!! ||| !! !::!!.! !!:!: ++{eu}AspGlyGlnAlaGlnTrpProProArgArgAlaProArgG 64930 : ............ag{TG}GATGGCCAGGCCCAGTGGCCTCCCAGGCGAGCTCCCAGGG : 72787 267 : ysValLysSerMetGln >>>> Target Intron 11 >>>> MetPheHisMe : 275 !!|||! !|||..!:!! 2615 bp ||| :!! luValThrSerGlnGlu++ ++MetGluAsnAl 72788 : AGGTGACATCGCAGGAGgt..........................agaTGGAAAATGC : 75429 276 : tProIleThrSerAlaMetGlnGlyAspArgLeu{Gl} >>>> Target Intron : 287 ||| !:!! !!!.!! !|||||| !|||{ !} 6641 bp aProAlaSerProGlySerGlyGlyAspTyrLeu{Ar}++ 75430 : ACCCGCCTCCCCGGGCAGTGGGGGGGATTACCTC{AG}gt.................. : 75469 288 : 12 >>>> {y}IleCysValThrGlnPheAspProLysLeuLeuGluArgGlyLeu : 302 {!}:!!! ! ! !!:! !|||!:!|||||| !! !! ! ++{g}LeuSerProArgArgProProProArgLeuLeuLeuCysArgGlu 75470 : ........ag{G}CTCTCTCCTCGCCGACCACCCCCCAGACTCTTGCTTTGCAGGGAA : 82151 303 : ValCysAlaPro{Gl} >>>> Target Intron 13 >>>> {u}SerLeuHis : 310 |||..!||||||{..} 16488 bp {!}!!!:!! ValAlaAlaPro{Ar}+- ++{g}ThrIleSer 82152 : GTGGCTGCACCA{AG}gc..........................ag{G}ACCATCTCA : 98663 311 : {T} >>>> Target Intron 14 >>>> {hr}ValHisAlaAlaLeuIleSer : 318 { } 9903 bp { !}!.! ::!|||! !:!!||| {G}++ ++{ly}AlaSerSerAlaArgLeuSer 98664 : {G}gt..........................ag{GA}GCCTCAAGCGCTCGACTCTCA : 108590 319 : ValGluLysIleProTyrPheArgGlyProLeuGlnThrLys{Al} >>>> Targe : 333 !||| !! !||| ! !! !!|||||||||||| !{!.} 1 SerGluTrpLysProAlaAlaGlyArgProLeuGlnThrAla{Va}++ 108591 : TCAGAGTGGAAACCAGCAGCCGGGCGGCCACTGCAAACGGCA{GT}gt.......... : 108639 334 : t Intron 15 >>>> {a}LysPheHisIleThrValGlyHisGluThrVal{Me} : 345 3625 bp {!} ! !|||:!:..! !||||||:!!|||!.!{ } ++{l}LeuGlyHisValValArgGlyHisGlnThrAla{Gl} 108640 : ................ag{G}CTGGGCCACGTGGTCCGCGGGCACCAGACGGCA{GG} : 122296 346 : >>>> Target Intron 16 >>>> {t}GlyArgLeuMetPhe >>>> Tar : 351 27282 bp {!}|||||| !... ++ ++{y}GlyArgAsnGlnGln++ 122297 : gt..........................ag{G}GGGAGAAATCAACAGgt........ : 149598 352 : get Intron 17 >>>> PheSerProAlaProAspAsnPheAspGlnGluProIl : 363 490 bp |||:::||| ... :::...|||:: ++AspLeuProSerProGlyThrGluProArgSerProVa 149599 : ..................aggatcttcccagcccagggactgaacccaggtctcctgt : 150122 364 : eLeuAsp >>>> Target Intron 18 >>>> SerPheAsnPheSerGlnGlu : 372 :|||... 24219 bp ... ||| lLeuGln++ -+PheLeuLeuPheHisPheVal 150123 : gttgcaggt..........................tgtttttgttgtttcattttgtt : 174368 373 : TyrLeuPheGlnGluGlnTyrLeuSerLysAspLeuThrProAlaValThr >>>> : 390 ::::::||| ...||||||||| ! :!!! !|||||| !|||.!! PheIlePheTyrProSerTyrLeuSerTyrAsnHisThrProHisValAla-+ 174369 : ttcattttttatccttCTTATTTGAGTTATAATCACACGCCTCACGTTGCAtt..... : 174424 391 : Target Intron 19 >>>> AspAsnAspGluAla{A} >>>> Target Int : 395 8049 bp |||!..|||! ! !{|} 2705 ++AspArgAspAlaAsp{A}++ 174425 : .....................agGACAGAGACGCTGAT{G}gt............... : 182489 396 : ron 20 >>>> {sp}LysLysAlaGlyGlnAlaThrGlu{Gl} >>>> Target : 404 bp {||}|||:::||| !::! !|||..!{.!} 12 ++{sp}LysArgAlaLeuArgHisThrArg{Se}++ 182490 : ...........ag{at}aaaagagCTCTGAGGCACACGAGG{AG}gt........... : 185222 405 : Intron 21 >>>> {y}HisCysProArgGlnGlnTrpAlaLeuValGluPheGl : 417 907 bp {!}!.! ||||||! |||.!!|||!.! ! ! -+{r}ArgValProArgProValTrpThrLeuAlaLeuAlaPr 185223 : ...............cg{C}CGTGTGCCCCGCCCTGTCTGGACCCTGGCACTGGCTCC : 198164 418 : uLysProValThrCysProArgLeu : 425 ! ||| !..!! !||||||||| oHisProArgValSerProArgLeu 198165 : CCACCCCCGTGTGTCCCCCAGGTTG : 198190 vulgar: SPP00000038_1.0 119 425 . NIVO01001699.1:subseq(3461309,210250) 570 198190 + 105 M 10 30 5 0 2 I 0 4623 3 0 2 M 6 18 5 0 2 I 0 2346 3 0 2 M 17 51 5 0 2 I 0 1844 3 0 2 M 5 15 S 0 1 5 0 2 I 0 5083 3 0 2 S 1 2 M 29 87 S 0 2 5 0 2 I 0 8032 3 0 2 S 1 1 M 4 12 S 0 1 5 0 2 I 0 2439 3 0 2 S 1 2 M 11 33 S 0 2 5 0 2 I 0 15391 3 0 2 S 1 1 M 23 69 5 0 2 I 0 20848 3 0 2 M 5 15 S 0 2 5 0 2 I 0 3317 3 0 2 S 1 1 M 17 51 S 0 1 5 0 2 I 0 7815 3 0 2 S 1 2 M 19 57 5 0 2 I 0 2611 3 0 2 M 15 45 S 0 2 5 0 2 I 0 6637 3 0 2 S 1 1 M 19 57 S 0 2 5 0 2 I 0 16484 3 0 2 S 1 1 M 3 9 S 0 1 5 0 2 I 0 9899 3 0 2 S 1 2 M 21 63 S 0 2 5 0 2 I 0 13621 3 0 2 S 1 1 M 11 33 S 0 2 5 0 2 I 0 27278 3 0 2 S 1 1 M 5 15 5 0 2 I 0 486 3 0 2 M 15 45 5 0 2 I 0 24215 3 0 2 M 24 72 5 0 2 I 0 8045 3 0 2 M 5 15 S 0 1 5 0 2 I 0 2701 3 0 2 S 1 2 M 8 24 S 0 2 5 0 2 I 0 12903 3 0 2 S 1 1 M 21 63 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 571 198190 105 + . gene_id 5 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 571 600 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 571 600 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 601 602 . + . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 601 5227 . + . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 5226 5227 . + . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 5228 5245 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 5228 5245 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 5246 5247 . + . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 5246 7595 . + . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 7594 7595 . + . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 7596 7646 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 7596 7646 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 7647 7648 . + . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 7647 9494 . + . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 9493 9494 . + . intron_id 2 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 9495 9510 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 9495 9510 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 9511 9512 . + . intron_id 4 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 9511 14597 . + . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 14596 14597 . + . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 14598 14688 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 14598 14688 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 14689 14690 . + . intron_id 5 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 14689 22724 . + . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 22723 22724 . + . intron_id 4 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 22725 22738 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 22725 22738 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 22739 22740 . + . intron_id 6 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 22739 25181 . + . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 25180 25181 . + . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 25182 25218 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 25182 25218 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 25219 25220 . + . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 25219 40613 . + . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 40612 40613 . + . intron_id 6 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 40614 40683 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 40614 40683 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 40684 40685 . + . intron_id 8 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 40684 61535 . + . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 61534 61535 . + . intron_id 7 ; splice_site "aa" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 61536 61552 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 61536 61552 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 61553 61554 . + . intron_id 9 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 61553 64873 . + . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 64872 64873 . + . intron_id 8 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 64874 64926 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 64874 64926 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 64927 64928 . + . intron_id 10 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 64927 72745 . + . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 72744 72745 . + . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 72746 72804 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 72746 72804 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 72805 72806 . + . intron_id 11 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 72805 75419 . + . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 75418 75419 . + . intron_id 10 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 75420 75466 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 75420 75466 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 75467 75468 . + . intron_id 12 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 75467 82107 . + . intron_id 12 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 82106 82107 . + . intron_id 11 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 82108 82167 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 82108 82167 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 82168 82169 . + . intron_id 13 ; splice_site "GC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 82168 98655 . + . intron_id 13 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 98654 98655 . + . intron_id 12 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 98656 98666 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 98656 98666 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 98667 98668 . + . intron_id 14 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 98667 108569 . + . intron_id 14 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 108568 108569 . + . intron_id 13 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 108570 108636 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 108570 108636 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 108637 108638 . + . intron_id 15 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 108637 122261 . + . intron_id 15 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 122260 122261 . + . intron_id 14 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 122262 122297 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 122262 122297 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 122298 122299 . + . intron_id 16 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 122298 149579 . + . intron_id 16 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 149578 149579 . + . intron_id 15 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 149580 149595 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 149580 149595 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 149596 149597 . + . intron_id 17 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 149596 150085 . + . intron_id 17 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 150084 150085 . + . intron_id 16 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 150086 150130 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 150086 150130 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 150131 150132 . + . intron_id 18 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 150131 174349 . + . intron_id 18 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 174348 174349 . + . intron_id 17 ; splice_site "tg" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 174350 174421 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 174350 174421 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 174422 174423 . + . intron_id 19 ; splice_site "TT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 174422 182470 . + . intron_id 19 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 182469 182470 . + . intron_id 18 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 182471 182486 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 182471 182486 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 182487 182488 . + . intron_id 20 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 182487 185191 . + . intron_id 20 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 185190 185191 . + . intron_id 19 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 185192 185219 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 185192 185219 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 185220 185221 . + . intron_id 21 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 185220 198126 . + . intron_id 21 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 198125 198126 . + . intron_id 20 ; splice_site "CG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 198127 198190 . + . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 198127 198190 . + . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 571 198190 105 + . alignment_id 5 ; Query SPP00000038_1.0 ; Align 571 120 30 ; Align 5228 130 18 ; Align 7596 136 51 ; Align 9495 153 15 ; Align 14600 159 87 ; Align 22726 189 12 ; Align 25184 194 33 ; Align 40615 206 69 ; Align 61536 229 15 ; Align 64875 235 51 ; Align 72748 253 57 ; Align 75420 272 45 ; Align 82109 288 57 ; Align 98657 308 9 ; Align 108572 312 63 ; Align 122263 334 33 ; Align 149581 346 15 ; Align 150086 351 45 ; Align 174350 366 72 ; Align 182471 390 15 ; Align 185194 396 24 ; Align 198128 405 63 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 2562 Query range: 0 -> 596 Target range: 160286 -> 49999 1 : MetAlaGlyArgArgValAsnValAsnValGlyValLeuGlyHisIleAspSerGlyL : 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MetAlaGlyArgArgValAsnValAsnValGlyValLeuGlyHisIleAspSerGlyL 160286 : ATGGCGGGCCGGCGGGTGAACGTGAACGTGGGCGTCCTGGGCCACATCGACAGCGGCA : 160229 21 : ysThrAlaLeuAlaArgAlaLeuSerThrThrAlaSerThrAlaAlaPheAspLysGl : 39 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ysThrAlaLeuAlaArgAlaLeuSerThrThrAlaSerThrAlaAlaPheAspLysGl 160228 : AGACGGCGCTGGCGCGCGCGCTCAGCACCACGGCCTCCACCGCCGCCTTCGACAAGCA : 160172 40 : nProGlnSerArgGluArgGlyIleThrLeuAspLeuGlyPheSerCysPheSerVal : 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| nProGlnSerArgGluArgGlyIleThrLeuAspLeuGlyPheSerCysPheSerVal 160171 : GCCGCAGAGCCGCGAGCGCGGCATCACGCTCGACCTGGGCTTCTCGTGCTTCTCCGTG : 160115 59 : ProLeuProAlaArgLeuArgSerSerLeuProGluPheGlnAlaAlaProGluAlaG : 78 ||||||||||||!.!|||||| !!||||||! |||: ProLeuProAlaHisLeuArg---------------------ProAlaProGlyAlaG 160114 : CCGCTGCCCGCGCACCTGCGG---------------------CCGGCGCCGGGCGCGC : 160076 79 : luProGluProGly<->GluProLeuLeuGlnValThrLeuValAspCysProGlyHi : 96 !!|||! !|||||| ||||||! !|||||||||||||||||||||||||||||||| lnProGlyProGlyProGluProArgLeuGlnValThrLeuValAspCysProGlyHi 160075 : AGCCCGGGCCCGGGCCCGAGCCGCGGCTGCAGGTCACGCTGGTCGACTGCCCGGGCCA : 160019 97 : sAlaSerLeuIleArgThrIleIleGly{G} >>>> Target Intron 1 >>>> : 106 ||||||||||||||||||||||||||||{|} 45239 bp sAlaSerLeuIleArgThrIleIleGly{G}++ 160018 : CGCGTCCCTCATCCGGACCATCATCGGC{G}gt......................... : 159986 107 : {ly}AlaGlnIleIleAspLeuMetMetLeuValIleAspValThrLysGlyMetG : 124 {||}|||||||||||||||||||||||||||||||||||||||||||||||||||| ++{ly}AlaGlnIleIleAspLeuMetMetLeuValIleAspValThrLysGlyMetG 159985 : ag{GG}GCCCAGATCATCGATCTCATGATGCTGGTCATCGACGTAACCAAGGGGATGC : 114696 125 : lnThrGlnSerAlaGluCysLeuValIleGlyGlnIleAlaCysGlnLysLeuValVa : 143 |||||||||||||||||||||||||||||||||||||||||||||||||||||:!!|| lnThrGlnSerAlaGluCysLeuValIleGlyGlnIleAlaCysGlnLysLeuIleVa 114695 : AGACCCAGTCGGCCGAGTGCCTCGTGATCGGGCAGATCGCCTGCCAGAAGCTGATCGT : 114639 144 : lValLeuAsnLysIleAspLeuLeuProGluGlyLysArgGlnAlaAlaIleAspLys : 162 |||||||||||||! !|||||||||||||||||||||||||||||||||||||||!:! lValLeuAsnLysThrAspLeuLeuProGluGlyLysArgGlnAlaAlaIleAspArg 114638 : GGTGCTGAACAAGACCGACCTCCTGCCCGAAGGGAAGAGACAGGCGGCGATCGACAGG : 114582 163 : MetThrLysLysMetGlnLysThrLeuGluAsnThr{Ly} >>>> Target Intr : 175 |||.!!||||||||||||!:!|||||||||||||||{||} 7216 bp MetAlaLysLysMetGlnArgThrLeuGluAsnThr{Ly}++ 114581 : ATGGCCAAGAAGATGCAGAGGACCCTGGAGAACACC{AA}gt................ : 114539 176 : on 2 >>>> {s}PheArgGlyAlaProIleIleProValAlaAlaLysProGlyGl : 190 {|}|||||||||||||||:!!|||||||||||||||||||||||||| ++{s}PheArgGlyAlaProValIleProValAlaAlaLysProGlyGl 114538 : .........ag{G}TTCCGGGGCGCACCTGTCATACCCGTTGCGGCCAAGCCTGGGGG : 107282 191 : yProGluAlaProGluThrGluAlaProGlnGlyIleProGluLeuIleGlu >>>> : 208 ||||!!:||||||||||||||||||||||||||||||||||||||||||||| yProAspAlaProGluThrGluAlaProGlnGlyIleProGluLeuIleGlu++ 107281 : ACCAGACGCCCCTGAAACGGAAGCTCCGCAGGGCATCCCGGAGCTCATCGAGgt.... : 107226 209 : Target Intron 3 >>>> LeuLeuThrSerGlnIleSerIleProThrArgAs : 219 787 bp ||||||..!|||||||||||||||||||||||||| ++LeuLeuValSerGlnIleSerIleProThrArgAs 107225 : .....................agCTCCTGGTGTCCCAGATCTCCATCCCGACGAGGGA : 106408 220 : pProSerGlyProPheLeuMetSerValAspHisCysPheSerIleLysGlyGlnGly : 238 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| pProSerGlyProPheLeuMetSerValAspHisCysPheSerIleLysGlyGlnGly 106407 : CCCCTCGGGGCCGTTCCTCATGTCCGTGGACCACTGCTTCTCCATCAAAGGCCAGGGC : 106351 239 : ThrValMetThrGlyThrIleLeuSerGlySerIleSerLeuGlyAspSerValGluI : 258 |||||||||||||||||||||||||||||||||:!!|||||||||||||||||||||| ThrValMetThrGlyThrIleLeuSerGlySerValSerLeuGlyAspSerValGluI 106350 : ACCGTGATGACGGGGACCATCCTCTCGGGCTCCGTCAGCCTCGGCGACAGCGTGGAGA : 106291 259 : leProAlaLeuLys >>>> Target Intron 4 >>>> ValValLysLysVal : 267 |||||||||||||| 37825 bp ||||||!:!|||||| leProAlaLeuLys++ ++ValValArgLysVal 106290 : TCCCGGCCCTCAAGgt.........................agGTGGTGAGGAAAGTG : 68439 268 : LysSerMetGlnMetPheHisMetProIleThrSerAlaMetGlnGlyAspArgLeuG : 287 |||||||||||||||||||||! !|||:!!!:!||||||:!!|||||||||||||||| LysSerMetGlnMetPheHisThrProValSerSerAlaValGlnGlyAspArgLeuG 68438 : AAGTCCATGCAAATGTTCCACACGCCCGTCAGCTCCGCGGTGCAGGGGGACCGGCTCG : 68379 288 : lyIleCysValThrGlnPheAspProLysLeuLeuGluArgGlyLeuValCysAlaPr : 306 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| lyIleCysValThrGlnPheAspProLysLeuLeuGluArgGlyLeuValCysAlaPr 68378 : GCATCTGCGTCACCCAGTTCGACCCCAAGCTGCTGGAGCGCGGCCTGGTATGCGCCCC : 68322 307 : oGluSerLeuHisThrValHisAlaAlaLeuIleSerValGluLysIleProTyrPhe : 325 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| oGluSerLeuHisThrValHisAlaAlaLeuIleSerValGluLysIleProTyrPhe 68321 : CGAGTCCCTGCACACGGTCCACGCGGCCCTCATCTCCGTGGAGAAGATCCCCTACTTC : 68265 326 : ArgGlyProLeuGlnThrLysAlaLysPheHisIleThrValGlyHisGluThrValM : 345 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ArgGlyProLeuGlnThrLysAlaLysPheHisIleThrValGlyHisGluThrValM 68264 : CGGGGGCCCCTGCAGACCAAGGCCAAGTTCCACATCACCGTGGGCCACGAGACGGTCA : 68205 346 : etGlyArgLeuMetPhePheSerProAlaProAspAsnPheAspGlnGluProIleLe : 364 ||||||||:!!||||||||||||||||||||||||!:!.!!|||!::||||||:!:|| etGlyArgValMetPhePheSerProAlaProAspSerLeuAspArgGluProValLe 68204 : TGGGCCGGGTGATGTTCTTCAGCCCCGCCCCCGACAGCCTCGACCGCGAGCCCGTGCT : 68148 365 : uAspSerPheAsnPheSerGlnGluTyrLeuPheGlnGluGlnTyrLeuSerLysAsp : 383 ||||||||||:!!||||||!::|||||||||||||||||||||||||||!!! !! ! uAspSerPheAspPheSerArgGluTyrLeuPheGlnGluGlnTyrLeuCysProGly 68147 : CGACTCCTTCGACTTCTCCCGCGAGTACCTCTTCCAGGAGCAGTACCTGTGCCCGGGC : 68091 384 : LeuThrProAlaValThrAspAsnAspGluAlaAspLysLysAlaGlyGlnAlaThrG : 403 ! !.!!||||||!.!.!!||| ..!|||||| !:!!|||||||||||||||:!!! ProAlaProAlaAlaAlaAspAlaSerGluAlaThrGluLysAlaGlyGlnAlaSerA 68090 : CCGGCCCCGGCTGCGGCCGACGCGTCTGAGGCCACCGAGAAGGCGGGCCAGGCCTCGG : 68031 404 : luGlyHisCysProArgGlnGlnTrpAlaLeuValGluPheGluLysProValThrCy : 422 !|||!.!|||||||||||||||||||||||||||||||||||||||||||||||||| laGlyArgCysProArgGlnGlnTrpAlaLeuValGluPheGluLysProValThrCy 68030 : CAGGCCGCTGCCCCCGGCAGCAGTGGGCCCTGGTGGAGTTTGAGAAGCCTGTCACCTG : 67974 423 : sProArgLeuCysLeuValIleGlySerArgLeuAspAlaAspIleHisThrAsnThr : 441 |||||||||||||||||||||||||||||||||||||||||||||||||.!!|||||| sProArgLeuCysLeuValIleGlySerArgLeuAspAlaAspIleHisAlaAsnThr 67973 : CCCGCGGCTGTGCCTGGTGATCGGCTCCAGGCTAGATGCCGACATCCACGCCAACACG : 67917 442 : CysArgLeuAlaPheHisGlyIleLeuLeuHisGlyLeuGluAspArgAsnTyrAlaA : 461 |||||||||||||||||||||:!!|||||||||||||||! !||||||:!!||||||! CysArgLeuAlaPheHisGlyValLeuLeuHisGlyLeuGlyAspArgAspTyrAlaG 67916 : TGCCGCCTGGCCTTCCACGGTGTCCTGCTGCACGGGCTGGGAGACAGGGACTACGCGG : 67857 462 : spSerPheLeuProArgLeuLysValTyrLysLeuLysHisLysHisGlyLeuValGl : 480 !:||| !|||||| !|||::!|||||||||||||||!!.|||||||||:!!||||| luSerThrLeuProAlaLeuArgValTyrLysLeuLysGlnLysHisGlyValValGl 67856 : AGAGCACCCTGCCTGCGCTGCGGGTGTACAAGCTGAAGCAGAAGCACGGCGTCGTGGA : 67800 481 : uArg >>>> Target Intron 5 >>>> AlaMetAspAspTyrSerValIleG : 490 |||| 4080 bp !.!:!!||||||:!!|||||||||| uArg++ ++ValLeuAspAspHisSerValIleG 67799 : GCGGgt.........................agGTGCTGGATGACCACAGCGTGATCG : 63690 491 : lyArgSerLeuPheLysLysGluThrAsnIleGlnLeuPheValGlyLeuLysValHi : 509 ||||||||||||||||||||||||||||||||||||||||||||||||||!:!||||| lyArgSerLeuPheLysLysGluThrAsnIleGlnLeuPheValGlyLeuArgValHi 63689 : GCCGCTCCCTGTTCAAGAAGGAGACCAACATCCAGCTGTTCGTGGGACTCAGGGTGCA : 63633 510 : sLeuSerThrGlyGluLeuGlyIleIleAspSerAlaPheGlyGlnSerGlyLysPhe : 528 ||||||||||||||||||||||:!!||||||||||||||||||||||||||||||||| sLeuSerThrGlyGluLeuGlyValIleAspSerAlaPheGlyGlnSerGlyLysPhe 63632 : CCTGTCTACCGGCGAGCTGGGCGTCATCGACAGCGCCTTTGGACAGAGCGGCAAATTC : 63576 529 : LysIleHisIlePro{G} >>>> Target Intron 6 >>>> {ly}GlyLeuS : 537 |||:!!|||||||||{|} 13373 bp {||}||||||| LysValHisIlePro{G}++ ++{ly}GlyLeuS 63575 : AAGGTCCACATCCCT{G}gt.........................ag{GT}GGCCTGA : 50176 538 : erProGluSerLysLysIleLeuThrProAlaLeuLysLysArgAlaArgAlaGlyAr : 556 |||||||||||||||||||||||||| !!|||||||||||||||!.!||||||||||| erProGluSerLysLysIleLeuThrSerAlaLeuLysLysArgGlyArgAlaGlyAr 50175 : GCCCCGAGTCCAAGAAGATCCTGACATCCGCCCTCAAGAAGCGGGGCCGTGCCGGCCG : 50119 557 : gGlyGluAlaThrArgGlnGluGluSerAlaGluArgSerGluProSerGlnHisVal : 575 ||||||||||.!!!:!! !|||||| ||||||||| !||||||:!!|||! !||| gGlyGluAlaAlaLysProGluGlu---AlaGluArgLeuGluProAlaGlnProVal 50118 : GGGCGAGGCAGCCAAGCCGGAGGAG---GCAGAGCGGCTGGAGCCTGCCCAGCCCGTG : 50065 576 : ValLeuSerLeuThrPheLysArgTyrValPheAspThrHisLysArgMetValGlnS : 595 ! !|||||||||:!!|||||||||||||||||||||.!!||||||||||||||||||| GlyLeuSerLeuSerPheLysArgTyrValPheAspAlaHisLysArgMetValGlnS 50064 : GGCCTCAGCCTGTCCTTCAAGCGCTACGTCTTCGACGCCCACAAGCGCATGGTCCAGT : 50005 596 : erPro : 596 ||||| erPro 50004 : CTCCC : 50000 vulgar: SPP00000038_1.0 0 596 . NIVO01001699.1:subseq(3461309,210250) 160286 49999 - 2562 M 65 195 G 7 0 M 10 30 G 0 3 M 23 69 S 0 1 5 0 2 I 0 45235 3 0 2 S 1 2 M 68 204 S 0 2 5 0 2 I 0 7212 3 0 2 S 1 1 M 32 96 5 0 2 I 0 783 3 0 2 M 55 165 5 0 2 I 0 37821 3 0 2 M 219 657 5 0 2 I 0 4076 3 0 2 M 52 156 S 0 1 5 0 2 I 0 13369 3 0 2 S 1 2 M 30 90 G 1 0 M 31 93 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 50000 160286 2562 - . gene_id 1 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 159989 160286 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 159989 160286 . - . insertions 3 ; deletions 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 159987 159988 . - . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 114750 159988 . - . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 114750 114751 . - . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 114542 114749 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 114542 114749 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 114540 114541 . - . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 107326 114541 . - . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 107326 107327 . - . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 107229 107325 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 107229 107325 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 107227 107228 . - . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 106442 107228 . - . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 106442 106443 . - . intron_id 2 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 106277 106441 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 106277 106441 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 106275 106276 . - . intron_id 4 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 68452 106276 . - . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 68452 68453 . - . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 67795 68451 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 67795 68451 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 67793 67794 . - . intron_id 5 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 63715 67794 . - . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 63715 63716 . - . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 63558 63714 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 63558 63714 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 63556 63557 . - . intron_id 6 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 50185 63557 . - . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 50185 50186 . - . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 50000 50184 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 50000 50184 . - . insertions 0 ; deletions 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 50000 160286 2562 - . alignment_id 1 ; Query SPP00000038_1.0 ; Align 160287 1 195 ; Align 160092 73 30 ; Align 160059 83 69 ; Align 114748 107 204 ; Align 107325 176 96 ; Align 106442 208 165 ; Align 68452 263 657 ; Align 63715 482 156 ; Align 50183 535 90 ; Align 50093 566 93 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 139 Query range: 17 -> 457 Target range: 210114 -> 7051 18 : SerGlyLysThrAlaLeuAlaArgAlaLeuSerThrThrAlaSerThrAlaAlaPheA : 37 ||||||||| !! !||| ! !! !:!!|||:!!:!! !!:!.!! ! ! !. SerGlyLysCysAspLeuLeuGlyLysValSerSerSerLeuAsnAlaLeuPheThrG 210114 : TCAGGGAAGTGTGACTTACTAGGAAAGGTTTCTTCATCACTAAATGCGTTATTCACTC : 210057 38 : spLysGlnProGlnSerArgGluArgGlyIleThrLeuAspLeuGlyPhe{Se} >> : 54 !.:!!::!|||::!!!!!!!:!!||| ! !|||!!!|||!!!..!|||{!.} lnGluArgProArgArgSerLysArgLeuHisThrPheAspPheSerPhe{Ly}++ 210056 : AGGAGAGGCCCAGGAGAAGCAAACGTTTGCACACATTTGACTTTTCTTTC{AA}gt.. : 210002 55 : >> Target Intron 1 >>>> {r}CysPheSerValProLeuPro{Al} >>> : 62 17818 bp {!}||| !! ! ! !||||||{::} ++{s}CysArgPheGlnMetLeuPro{Se}++ 210001 : .......................ag{G}TGTCGTTTCCAGATGCTGCCC{AG}gt... : 192160 63 : > Target Intron 2 >>>> {a}ArgLeuArgSerSerLeuProGluPheGlnA : 73 26719 bp {!}||| !||| ||| ||| ::!| ++{r}ArgArgArgCysSerArgProGlySerLysA 192159 : ......................ag{C}AGAAGACggtgtagcaggccaggctccaaGG : 165412 74 : laAlaProGlu{Al} >>>> Target Intron 3 >>>> {a}GluProGluPr : 81 ||::! !! { } 5789 bp {!} |||... laSerGluGly{Ar}++ ++{g}IleProArgTh 165411 : CGAGTGAAGGT{CG}gt.........................ag{a}atcccgcggac : 159599 82 : oGlyGluPro{L} >>>> Target Intron 4 >>>> {eu}LeuGlnValThr : 89 |||||||||{ } 21090 bp { !} !||| !!:! rGlyGluPro{A}++ ++{la}AlaGlnSerSer 159598 : aggggaacct{g}gt.........................ag{CT}GCTCAGAGCAGC : 138485 90 : LeuValAspCysProGlyHisAlaSerLeuIleArgThr{Il} >>>> Target I : 103 :!!:!! !..!|||||| !|||||| ! |||:!!{:!} 642 ValLeuCysAlaProGlyGlyAlaSerAlaGlyArgSer{Va}++ 138484 : GTCCTCTGTGCCCCTGGAGGCGCCTCTGCCGGGCGTTCC{GT}gt............. : 138439 104 : ntron 5 >>>> {e}IleGlyGlyAlaGlnIleIleAspLeuMetMetLeuValIl : 117 bp {!}! !|||||| !! ! !:!! ||| :!!! !! ! ++{l}ThrGlyGlyArgProAlaLeuTrpLeuHisLeuSerGluCy 138438 : ............ag{C}ACTGGCGGTCGTCCGGCTCTCTGGCTGCACCTGTCCGAGTG : 137759 118 : eAspValThrLysGlyMetGlnThrGlnSerAlaGlu >>>> Target Intron : 130 !! :!! !...! !:!:! ! !! !.!!|||||| 24676 bp sValMetCysSerValValLeuGlyProGlyAlaGlu++ 137758 : TGTGATGTGCTCTGTCGTCCTGGGGCCGGGGGCTGAGgt................... : 137718 131 : 6 >>>> CysLeuValIleGlyGlnIle{Al} >>>> Target Intron 7 >> : 137 |||||| :::|||::: !{!.} 605 bp ++CysLeuGluValGlyArgPro{Gl}++ 137717 : ......agtgcctggaggtggggaggccC{GG}gt....................... : 113019 138 : >> {a}CysGlnLysLeuValValValLeuAsnLysIleAspLeu >>>> Targe : 151 {!}|||:!!::: !||||||!.!|||||| .!!! ! 3 +-{y}CysLysArgThrValValAlaLeuAsnAlaPheAlaGlu-+ 113018 : ..at{G}TGTAAACGCACTGTTGTGGCGTTGAACGCCTTCGCAGAGct.......... : 112374 152 : t Intron 8 >>>> LeuProGluGlyLysArgGlnAlaAlaIleAspLysMetTh : 164 320 bp !|||! !!.!!:!! !!::!.!|||:!!..!!:! .! ++GluProAlaAlaArgThrArgGlyAlaLeuSerArgProAl 112373 : ...............agGAGCCAGCAGCCAGGACACGCGGGGCGCTCAGCAGACCAGC : 109017 165 : r{L} >>>> Target Intron 9 >>>> {ys}LysMetGlnLysThrLeuGlu : 172 !{ } 5810 bp { !} ! !:!||| !! ! a{G}+- ++{ly}ProArgGlyArgThrGlyVal 109016 : A{G}gc.........................ag{GG}CCCCGGGGCAGGACTGGAGTG : 103183 173 : AsnThrLysPheArgGlyAlaProIleIleProValAlaAlaLysProGlyGlyProG : 192 ..! ! .!! !|||||| !:!: !|||! !.!! !!:!!|||!.!||||||! GlyGlyGlyLeuSerGlyAlaGlyLeuArgProGlyThrProGlnProAlaGlyProG 103182 : GGCGGTGGCCTCTCTGGTGCGGGGCTGCGTCCTGGCACCCCCCAGCCAGCAGGCCCAG : 103123 193 : luAlaProGluThrGluAlaProGlnGlyIleProGluLeuIleGluLeuLeuThrSe : 211 ! ! !! !!:!:!!||||||::!!.!:!:|||..!|||! ! |||! ! !|| lyLeuMetValSerGlnAlaProArgAlaValProArgLeuSerProLeuProArgSe 103122 : GACTGATGGTAAGCCAGGCACCCAGGGCTGTGCCCCGGCTGAGCCCTCTGCCTCGCTC : 103066 212 : rGlnIleSerIlePro{Th} >>>> Target Intron 10 >>>> {r}ArgAs : 219 |... !:!!:!! !!{ } 2119 bp {!}!:!! rSerSerAlaValSer{Tr}++ ++{p}LysGl 103065 : CTCCTCAGCCGTTTCC{TG}gt..........................ag{G}AAGGG : 100923 220 : pProSerGlyProPheLeuMetSerVal{A} >>>> Target Intron 11 >>> : 229 !|||:!!||||||.!! ! |||! !{!} 3090 bp yProAlaGlyProLeuAsnProSerGly{G}-+ 100922 : CCCGGCAGGGCCGCTTAACCCTTCAGGA{G}ct......................... : 100890 230 : > {sp}HisCysPheSerIleLysGlyGln >>>> Target Intron 12 >>> : 238 { !}|||... !:!! !!:!|||||| 874 bp ++{ly}HisAlaAlaAlaCysArgGlyGln++ 100889 : .ag{GC}CACGCGGCTGCTTGCAGAGGCCAGgt......................... : 97774 239 : > GlyThrValMetThrGlyThrIleLeuSerGlySerIleSerLeuGlyAspSerV : 256 ||| !:!! ! ! !! !:!!! ! !||||||:!!||| ! ! ! ++GlyLeuLeuProIleGlnArgValCysLeuGlySerValSerAlaProThrHisT 97773 : .agGGGCTCTTGCCCATCCAGAGGGTCTGTCTGGGGTCTGTCTCCGCCCCCACACACT : 96848 257 : alGluIleProAlaLeu{L} >>>> Target Intron 13 >>>> {ys}ValV : 264 !:!!:!!||| {:} 5180 bp {!!} !: rpLysLeuProGluGln{G}++ ++{lu}ProM 96847 : GGAAGCTCCCTgagcag{g}gt..........................ag{AG}CCCA : 91644 265 : alLysLysValLysSer >>>> Target Intron 14 >>>> MetGlnMetPh : 273 !! !:::|||:!! !! 4970 bp ! |||:!:|| etGlyArgValGluPro++ ++ArgGlnLeuPh 91643 : TGGGGCGTGTGGAACCCgt..........................agAGACAGCTTTT : 86647 274 : eHisMetProIleThrSerAlaMetGlnGlyAsp{Ar} >>>> Target Intron : 285 ||||:!!|||:!! !||||||:!:!:: !..!{..} 4347 bp eHisLeuProValGlySerAlaValArgPheSer{Gl}++ 86646 : CCATCTGCCTGTCGGCTCGGCTGTCCGCTTTTCT{GA}gt.................. : 86607 286 : 15 >>>> {g}LeuGlyIleCysValThr{G} >>>> Target Intron 16 : 292 {!} !||| |||:!!.!!{|} 4421 bp ++{u}SerGlyGlnCysLeuAla{G}+- 86606 : ........ag{A}AGCGGCCAGTGTTTGGCA{C}gc...................... : 82240 293 : >>>> {ln}PheAspProLysLeuLeuGluArgGlyLeuValCysAlaProGluSer : 308 {||}||| !|||::: !||| !!|||||| !..!:!!|||! ||| -+{ln}PheCysProArgGlyLeuProGlyGlyLeuProAlaSerProAlaSer 82239 : ....cg{AG}TTCTGTCCCCGCGGGCTGCCCGGGGGTCTTCCAGCCTCCCCAGCCAGC : 77774 309 : {Le} >>>> Target Intron 17 >>>> {u}HisThrValHisAlaAlaLeu : 316 { } 10520 bp {!}|||!:!||| ! !|||||| {Ar}++ ++{g}HisSerValValPheAlaLeu 77773 : {AG}gt..........................ag{G}CATAGTGTCGTCTTTGCTCTG : 67230 317 : IleSerValGluLysIlePro >>>> Target Intron 18 >>>> TyrPheA : 326 !:!! !..!::!:!! !! 2943 bp !|||| AlaAlaCysArgArgValSer++ ++ValPheA 67229 : GCCGCCTGCAGACGAGTTTCAgt..........................agGTTTTTA : 64257 327 : rg >>>> Target Intron 19 >>>> GlyProLeuGlnThrLys{A} >>> : 333 || 4892 bp ||||||! !||| !! {!} rg++ ++GlyProProGlnProAla{G}++ 64256 : GGgt..........................agGGGCCCCCACAACCAGCT{G}gt... : 59341 334 : > Target Intron 20 >>>> {la}LysPheHisIleThrValGlyHisGluTh : 343 15866 bp {.!}!:! !! !||| !||| !! !! !.! ++{ly}ArgValSerIleGlnValHisProAlaAl 59340 : .......................ag{GG}AGAGTCAGCATCCAGGTCCATCCTGCAGC : 43448 344 : rValMetGlyArgLeuMet >>>> Target Intron 21 >>>> PhePheSer : 352 ! !|||||||||||| 3953 bp !!! aSerMetGlyArgLeuPro-+ ++LysGlnThr 43447 : TTCCATGGGCCGCCTGCCCct..........................agAAACAGACA : 39468 353 : ProAlaProAsp >>>> Target Intron 22 >>>> AsnPheAspGlnGluP : 362 !||||||!!: 2694 bp !!. !!!::!!..! LysAlaProGlu++ ++LysAlaGluGluArgG 39467 : AAAGCCCCTGAGgt..........................agAAGGCTGAGGAGAGAG : 36744 363 : roIleLeuAspSerPheAsnPheSerGlnGluTyrLeuPheGlnGluGlnTyrLeuSe : 381 ! !!!:!!!.!!!.. !..! !:!!!::! ! |||! ||| ! !:! luTrpThrGluThrIleArgHisGlnAlaGlnTrpProLysGlnGlyGlnGlyArgAl 36743 : AATGGACCGAGACAATCAGGCATCAGGCGCAGTGGCCCAAGCAGGGCCAAGGGCGTGC : 36687 382 : rLysAspLeuThrProAlaValThrAspAsnAspGluAlaAsp >>>> Target I : 396 !|||! !|||..!|||!.! !:!! |||:!!:!!|||!!: 75 aLysAlaLeuValProGlyCysSerArgAsnAsnGlnAlaGlu++ 36686 : AAAGGCCCTGGTGCCTGGCTGCTCCAGGAACAACCAGGCTGAGgt............. : 36640 397 : ntron 23 >>>> Lys{L} >>>> Target Intron 24 >>>> {ys}Ala : 398 bp ..!{ } 10812 bp { } ! ++Ser{G}++ ++{ly}Leu 36639 : .............agTCA{G}gt..........................ag{GC}TTG : 25749 399 : GlyGlnAlaThrGluGlyHisCysProArgGln >>>> Target Intron 25 > : 410 ..! !.!.!!||||||...||||||!:!:!! 834 bp SerThrGlyAlaGluGlyArgCysProGlnGlu++ 25748 : TCCACTGGGGCTGAGGGAAGGTGCCCACAGGAGgt....................... : 25711 411 : >>> GlnTrpAla{Le} >>>> Target Intron 26 >>>> {u}ValGluP : 416 |||||| !{ } 5819 bp {!}:!!.!.! -+GlnTrpLeu{Se}++ ++{r}IleHisS 25710 : ...ggCAGTGGCTC{AG}gt..........................ag{C}ATCCACT : 19042 417 : heGluLysProValThrCysProArgLeuCysLeuValIleGlySerArgLeuAspAl : 435 ! ! !! !! ! !!! !|||!!!:!!|||! !||| !|||||||||! ! ! er***GlyArgGlyProSerProSerIleCysSerValProGlySerArgProProLe 19041 : CCTGAGGACGGGGGCCCTCCCCCAGTATCTGCTCTGTGCCTGGATCACGGCCTCCCCT : 18985 436 : aAspIleHisThrAsnThrCys{Ar} >>>> Target Intron 27 >>>> {g : 443 !||| |||!:!:!!.!!!! {||} 1680 bp {| uAspProHisSerHisAlaTrp{Ar}++ ++{g 18984 : AGATCCGCACAGCCACGCCTGG{AG}gt..........................ag{G : 17279 444 : }LeuAlaPheHisGlyIleLeu >>>> Target Intron 28 >>>> >>>> : 451 } ! !|||!!.|||.!!||| 1842 bp }ArgHisPheGlnGlyPheLeu++ ++++ 17278 : }AGGCATTTTCAAGGCTTCCTAgt..........................aggt.... : 15413 452 : Target Intron 29 >>>> LeuHisGlyLeuGluAspArg : 457 8343 bp !!! ||||||:!!|||||| ++PheTrpGlyLeuLysAspArg 15412 : ......................agTTCTGGGGACTCAAAGATAGG : 7052 vulgar: SPP00000038_1.0 17 457 . NIVO01001699.1:subseq(3461309,210250) 210114 7051 - 139 M 36 108 S 0 2 5 0 2 I 0 17814 3 0 2 S 1 1 M 7 21 S 0 2 5 0 2 I 0 26715 3 0 2 S 1 1 M 14 42 S 0 2 5 0 2 I 0 5785 3 0 2 S 1 1 M 7 21 S 0 1 5 0 2 I 0 21086 3 0 2 S 1 2 M 17 51 S 0 2 5 0 2 I 0 638 3 0 2 S 1 1 M 26 78 5 0 2 I 0 24672 3 0 2 M 7 21 S 0 2 5 0 2 I 0 601 3 0 2 S 1 1 M 13 39 5 0 2 I 0 3316 3 0 2 M 14 42 S 0 1 5 0 2 I 0 5806 3 0 2 S 1 2 M 51 153 S 0 2 5 0 2 I 0 2115 3 0 2 S 1 1 M 11 33 S 0 1 5 0 2 I 0 3086 3 0 2 S 1 2 M 8 24 5 0 2 I 0 870 3 0 2 M 24 72 S 0 1 5 0 2 I 0 5176 3 0 2 S 1 2 M 7 21 5 0 2 I 0 4966 3 0 2 M 15 45 S 0 2 5 0 2 I 0 4343 3 0 2 S 1 1 M 6 18 S 0 1 5 0 2 I 0 4417 3 0 2 S 1 2 M 16 48 S 0 2 5 0 2 I 0 10516 3 0 2 S 1 1 M 14 42 5 0 2 I 0 2939 3 0 2 M 3 9 5 0 2 I 0 4888 3 0 2 M 6 18 S 0 1 5 0 2 I 0 15862 3 0 2 S 1 2 M 16 48 5 0 2 I 0 3949 3 0 2 M 7 21 5 0 2 I 0 2690 3 0 2 M 39 117 5 0 2 I 0 71 3 0 2 M 1 3 S 0 1 5 0 2 I 0 10808 3 0 2 S 1 2 M 12 36 5 0 2 I 0 830 3 0 2 M 3 9 S 0 2 5 0 2 I 0 5815 3 0 2 S 1 1 M 29 87 S 0 2 5 0 2 I 0 1676 3 0 2 S 1 1 M 7 21 5 0 2 I 0 1838 3 0 2 5 0 2 I 0 8339 3 0 2 M 7 21 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 7052 210114 139 - . gene_id 2 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 210005 210114 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 210005 210114 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 210003 210004 . - . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 192187 210004 . - . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 192187 192188 . - . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 192163 192186 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 192163 192186 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 192161 192162 . - . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 165444 192162 . - . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 165444 165445 . - . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 165399 165443 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 165399 165443 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 165397 165398 . - . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 159610 165398 . - . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 159610 159611 . - . intron_id 2 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 159587 159609 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 159587 159609 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 159585 159586 . - . intron_id 4 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 138497 159586 . - . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 138497 138498 . - . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 138442 138496 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 138442 138496 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 138440 138441 . - . intron_id 5 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 137800 138441 . - . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 137800 137801 . - . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 137721 137799 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 137721 137799 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 137719 137720 . - . intron_id 6 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 113045 137720 . - . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 113045 113046 . - . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 113022 113044 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 113022 113044 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 113020 113021 . - . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 112417 113021 . - . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 112417 112418 . - . intron_id 6 ; splice_site "AT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 112377 112416 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 112377 112416 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 112375 112376 . - . intron_id 8 ; splice_site "CT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 109057 112376 . - . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 109057 109058 . - . intron_id 7 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 109014 109056 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 109014 109056 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 109012 109013 . - . intron_id 9 ; splice_site "GC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 103204 109013 . - . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 103204 103205 . - . intron_id 8 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 103047 103203 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 103047 103203 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 103045 103046 . - . intron_id 10 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 100928 103046 . - . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 100928 100929 . - . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 100893 100927 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 100893 100927 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 100891 100892 . - . intron_id 11 ; splice_site "CT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 97803 100892 . - . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 97803 97804 . - . intron_id 10 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 97777 97802 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 97777 97802 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 97775 97776 . - . intron_id 12 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 96903 97776 . - . intron_id 12 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 96903 96904 . - . intron_id 11 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 96830 96902 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 96830 96902 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 96828 96829 . - . intron_id 13 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 91650 96829 . - . intron_id 13 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 91650 91651 . - . intron_id 12 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 91627 91649 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 91627 91649 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 91625 91626 . - . intron_id 14 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 86657 91626 . - . intron_id 14 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 86657 86658 . - . intron_id 13 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 86610 86656 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 86610 86656 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 86608 86609 . - . intron_id 15 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 82263 86609 . - . intron_id 15 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 82263 82264 . - . intron_id 14 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 82243 82262 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 82243 82262 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 82241 82242 . - . intron_id 16 ; splice_site "GC" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 77822 82242 . - . intron_id 16 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 77822 77823 . - . intron_id 15 ; splice_site "CG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 77770 77821 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 77770 77821 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 77768 77769 . - . intron_id 17 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 67250 77769 . - . intron_id 17 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 67250 67251 . - . intron_id 16 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 67207 67249 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 67207 67249 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 67205 67206 . - . intron_id 18 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 64264 67206 . - . intron_id 18 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 64264 64265 . - . intron_id 17 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 64255 64263 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 64255 64263 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 64253 64254 . - . intron_id 19 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 59363 64254 . - . intron_id 19 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 59363 59364 . - . intron_id 18 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 59344 59362 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 59344 59362 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 59342 59343 . - . intron_id 20 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 43478 59343 . - . intron_id 20 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 43478 43479 . - . intron_id 19 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 43428 43477 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 43428 43477 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 43426 43427 . - . intron_id 21 ; splice_site "CT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 39475 43427 . - . intron_id 21 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 39475 39476 . - . intron_id 20 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 39454 39474 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 39454 39474 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 39452 39453 . - . intron_id 22 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 36760 39453 . - . intron_id 22 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 36760 36761 . - . intron_id 21 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 36643 36759 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 36643 36759 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 36641 36642 . - . intron_id 23 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 36568 36642 . - . intron_id 23 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 36568 36569 . - . intron_id 22 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 36564 36567 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 36564 36567 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 36562 36563 . - . intron_id 24 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 25752 36563 . - . intron_id 24 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 25752 25753 . - . intron_id 23 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 25714 25751 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 25714 25751 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 25712 25713 . - . intron_id 25 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 24880 25713 . - . intron_id 25 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 24880 24881 . - . intron_id 24 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 24869 24879 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 24869 24879 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 24867 24868 . - . intron_id 26 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 19050 24868 . - . intron_id 26 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 19050 19051 . - . intron_id 25 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 18960 19049 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 18960 19049 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 18958 18959 . - . intron_id 27 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 17280 18959 . - . intron_id 27 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 17280 17281 . - . intron_id 26 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 17258 17279 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 17258 17279 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 17256 17257 . - . intron_id 28 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 15416 17257 . - . intron_id 28 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 15416 15417 . - . intron_id 27 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 15414 15415 . - . intron_id 29 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 7073 15415 . - . intron_id 29 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 7073 7074 . - . intron_id 28 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 7052 7072 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 7052 7072 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 7052 210114 139 - . alignment_id 2 ; Query SPP00000038_1.0 ; Align 210115 18 108 ; Align 192186 55 21 ; Align 165443 63 42 ; Align 159609 78 21 ; Align 138495 86 51 ; Align 137799 104 78 ; Align 113045 130 21 ; Align 112416 138 39 ; Align 109057 151 42 ; Align 103202 166 153 ; Align 100927 218 33 ; Align 97801 230 24 ; Align 96903 238 72 ; Align 91648 263 21 ; Align 86657 270 45 ; Align 82262 286 18 ; Align 77820 293 48 ; Align 67249 310 42 ; Align 64264 324 9 ; Align 59363 327 18 ; Align 43476 334 48 ; Align 39475 350 21 ; Align 36760 357 117 ; Align 36568 396 3 ; Align 25750 398 36 ; Align 24880 410 9 ; Align 19049 414 87 ; Align 17279 444 21 ; Align 7073 451 21 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 116 Query range: 10 -> 437 Target range: 206772 -> 1047 11 : GlyValLeuGlyHisIleAspSerGlyLysThrAlaLeuAlaArgAlaLeuSerThrT : 30 ||||||! !! !!!.:!: |||! !!:! !!.! !|||! !||| !.!! ! GlyValGlnValGlnValArgSerGluArgLeuValGluAlaThrAlaArgGlyGlnC 206772 : GGCGTCCAAGTGCAGGTGAGGTCAGAGAGGCTGGTGGAGGCCACTGCGAGGGGCCAGT : 206715 31 : hrAlaSerThrAlaAlaPheAspLysGlnProGlnSerArgGluArgGlyIleThrLe : 49 !!.!..! ! !!..!!:: !||||||! !.!!|||! !||||||:!: !! ysValGluGlyProCysTrpArgProGlnProProGlyArgAlaArgGlyLeuHisSe 206714 : GTGTGGAAGGCCCGTGCTGGAGGCCGCAACCCCCGGGCAGGGCGAGGGGGCTGCACTC : 206658 50 : uAspLeuGly{Ph} >>>> Target Intron 1 >>>> {e}SerCysPheSer : 57 !!!::!!|||{ } 5985 bp { } !|||||| !! rGluValGly{Gl}++ ++{y}ValCysPhePro 206657 : AGAGGTGGGA{GG}gt.........................ag{G}GTCTGTTTCCCT : 200649 58 : Val{P} >>>> Target Intron 2 >>>> {ro}LeuProAlaArgLeuArgS : 66 :!!{ } 15873 bp {!!}|||||| !! !|||!!!: Leu{A}++ ++{la}LeuProArgProLeuSerA 200648 : CTT{G}gt.........................ag{CC}CTCCCCAGACCGCTCAGCG : 184749 67 : erSerLeuPro >>>> Target Intron 3 >>>> GluPheGlnAlaAlaPro : 75 !!:!!! !||| 27845 bp ||||||::!..!:!!||| laAlaSerPro++ ++GluPheArgCysSerPro 184748 : CTGCGTCTCCTgt.........................agGAATTCAGGTGTTCCCCT : 156877 76 : Glu >>>> Target Intron 4 >>>> AlaGluProGluProGlyGluProLe : 85 .!. 26291 bp |||... !!...|||! !! !!|| His++ ++AlaSerAlaArgProValGlySerLe 156876 : CATgt.........................agGCTTCCGCACGCCCAGTGGGCTCCCT : 130556 86 : uLeuGlnValThrLeuValAspCysProGly >>>> Target Intron 5 >>>> : 96 | !.!.||| !|||..!.!.... ||| 19351 bp uAlaAspValGlnLeuThrGlnAlaLeuGly++ 130555 : GGCTGATGTCCAGCTGACTCAGgccctgggggt......................... : 130521 97 : HisAlaSerLeuIleArgThrIleIleGlyGlyAlaGlnIleIleAspLeuMetMe : 114 ||| !! !:!!:!!|||! !:!!! !||| !||| !! !:!:!!::!!:!::! ++HisArgMetValValArgIleValThrGlyThrAlaLeuAsnLeuGluValValLe 130520 : agCACAGAATGGTGGTTAGAATTGTAACAGGGACTGCTTTGAATCTGGAGGTGGTTTT : 111118 115 : tLeuValIleAspValThrLysGly >>>> Target Intron 6 >>>> MetG : 124 : ! !!!:|||..! !! !||| 1725 bp . uGlyArgMetAspThrLeuThrGly++ +-ThrH 111117 : AGGTAGAATGGACACCTTAACAGGAgt.........................acacgc : 109363 125 : lnThrGlnSerAlaGluCysLeuValIleGlyGlnIle{Al} >>>> Target In : 137 ..|||||| ! !|||:!!:!!:!!!.!.!.:!:{ } 10202 isThrGlnMetProValCysValIleLeuAlaAspLeu{Ar}++ 109362 : acacacagatgcccGTGTGTGTGATTTTAGCTGATCTG{AG}gt.............. : 109320 138 : tron 7 >>>> {a}CysGlnLysLeuValValValLeuAsnLysIleAspLeuLeu : 151 bp {!}... :::||| ! !|||:!! :!: !|||||| ++{g}AlaCysArgLeuProLysValIleLeuGlyLeuPheLeuLeu 109319 : ...........ag{A}GCGTGCCGCTTGCCAAAGGTTATTTTGGGTCTGTTTTTGCTT : 99080 152 : Pro{Gl} >>>> Target Intron 8 >>>> {u}GlyLysArgGlnAlaAlaI : 160 !{..} 1174 bp {.}||| ! |||::!!.!|||: Ile{Se}++ ++{r}GlyHisArgArgValAlaV 99079 : ATC{AG}gt.........................ag{C}GGACATCGCAGGGTTGCCG : 97879 161 : leAsp >>>> Target Intron 9 >>>> LysMetThrLysLysMetGln{Ly : 169 !!||| 9176 bp ::::!: !! !..!|||{!: alAsp++ ++ArgLeuProCysLeuGlnGln{Ar 97878 : TTGACgt.........................agCGCCTCCCCTGCCTGCAGCAG{AG : 88676 170 : } >>>> Target Intron 10 >>>> {s}ThrLeuGluAsnThrLysPheArg : 177 } 7786 bp {!} !! ! ||||||::! ! ! }+- ++{g}ArgProThrAsnThrArgGlyPro 88675 : }gg..........................ag{G}CGACCCACTAACACCCGGGGACCA : 80866 178 : GlyAlaProIleIlePro{V} >>>> Target Intron 11 >>>> {al}Ala : 185 ||||||||| !|||{|} 3634 bp {||}:!! GlyAlaProGlnGlyPro{V}++ ++{al}Ser 80865 : GGCGCCCCACAGGGTCCG{G}gt..........................ag{TT}TCT : 77208 186 : AlaLysPro{G} >>>> Target Intron 12 >>>> {ly}GlyProGlu{A} : 193 !:!!|||{|} 8744 bp {||}||| !|||{:} ArgGluPro{G}++ ++{ly}GlyGluGlu{S} 77207 : AGGGAACCA{G}gt..........................ag{GT}GGTGAGGAA{A} : 68440 194 : >>>> Target Intron 13 >>>> {la}ProGluThrGluAlaProGlnGly : 201 2067 bp {:!}|||:!! !!|||||| ! ..! ++ -+{er}ProGlnProGluAlaValAlaSer 68439 : gt..........................cg{GC}CCCCAGCCAGAAGCTGTGGCCTCT : 66349 202 : IleProGluLeuIleGluLeu{Le} >>>> Target Intron 14 >>>> {u} : 209 :!! !||||||:!:|||! !{! } 19603 bp {!} LeuMetGluLeuValGluArg{Cy}++ ++{s} 66348 : CTAATGGAGCTGGTGGAACGC{TG}gt..........................ag{C} : 46720 210 : ThrSerGlnIleSerIleProThrArgAspProSer{G} >>>> Target Intro : 222 !.!!:!!:!:|||||||||:!! !!||| !!!!{!} 3280 bp LeuGlyGluLeuSerIleProSerGlyAspGlyArg{A}++ 46719 : CTCGGGGAGCTGTCCATCCCATCTGGGGACGGGAGA{G}gt................. : 46680 223 : n 15 >>>> {ly}ProPheLeuMetSerValAspHisCysPheSerIleLysGlyG : 237 { !}||| !! |||..! ! !! :!! ! !! ! ++{sp}ProThrAlaThrSerThrThrLeuSerThrAlaGlnAlaAspV 46679 : .........ag{AC}CCCACAGCCACCAGCACCACACTTTCAACAGCACAAGCAGATG : 43358 238 : lnGlyThrValMetThrGlyThrIleLeuSerGlySerIleSerLeuGly{A} >>> : 254 !||| !!|||! ! !!|||||| !:!!||| !|||:!:.!!! ! !{|} alGlyProValArgProGlyThrGlyValSerProSerValGlyProGln{A}-+ 43357 : TGGGCCCAGTGAGGCCTGGAACAGGTGTCTCACCCTCTGTGGGCCCACAA{G}at... : 43304 255 : > Target Intron 16 >>>> {sp}SerValGluIleProAlaLeuLysValVa : 264 3791 bp {||}! !:!!:!!! !||| !:!!::::!!:! -+{sp}LeuIleLysSerProPheValArgLeuLe 43303 : .......................tg{AT}TTAATTAAAAGCCCTTTTGTACGTCTCTT : 39486 265 : lLysLysValLysSerMetGlnMetPheHisMetProIleThrSerAlaMetGlnGly : 283 !..! !|||..!! :!! !.!.:!! !! ! !!:!! !! ..!||| uSerLeuGlnLysGlnThrLysAlaProGluValGlySerProAlaProAspSerGly 39485 : GTCACTTCAGAAACAGACAAAAGCCCCTGAGGTGGGCAGCCCGGCCCCCGACTCAGGG : 39429 284 : AspArgLeuGly >>>> Target Intron 17 >>>> IleCysValThrGlnP : 293 !||| !||| 6358 bp !...:!!|||! !! ProArgAlaGly++ ++GlyAlaLeuThrProC 39428 : CCCAGGGCCGGGgt..........................agGGAGCACTCACCCCAT : 33041 294 : heAspProLysLeuLeuGluArgGlyLeuValCysAlaProGluSerLeuHisThrVa : 312 ! !|||::::!!! !:!!..!! !! !!.!||| ! !!||| !! ! !.. ysLeuProArgIleCysGlnGluGluArgAlaCysLysAlaGluProArgAlaAspTh 33040 : GCCTCCCTCGCATCTGCCAGGAAGAGCGGGCTTGCAAGGCTGAGCCCAGGGCAGACAC : 32984 313 : lHisAlaAlaLeuIleSerValGluLysIleProTyrPheArgGlyProLeuGlnThr : 331 ! !:!! ! !! !||| !|||:!!:!!|||!::.!!|||!.! !! !||| ! rSerSerPheSerThrSerArgGluGlnLeuProTrpLeuArgAlaAlaAlaGlnAsp 32983 : GTCCTCGTTCAGCACAAGTCGTGAGCAGCTTCCGTGGCTCCGGGCTGCAGCCCAGGAC : 32927 332 : LysAla{L} >>>> Target Intron 18 >>>> {ys}PheHisIleThrVal : 339 !:!!.!{|} 719 bp {||} ! |||! !|||!.! ArgVal{L}++ ++{ys}ValHisSerThrAla 32926 : AGAGTT{A}gt..........................ag{AG}GTGCACAGCACGGCA : 32184 340 : GlyHisGluThr{V} >>>> Target Intron 19 >>>> {al}MetGlyArg : 347 ||| ! ! !{|} 2150 bp {||} !..! GlySerThrGly{V}++ ++{al}SerHisGlu 32183 : GGGTCCACAGGA{G}gt..........................ag{TG}TCTCACGAA : 30010 348 : LeuMetPhePheSerProAlaProAspAsnPheAspGlnGluProIleLeuAspSerP : 367 ! !:!: ||||||! !! !|||..!..!! !! .!.!!: ! ::: ... ProLeuArgPheSerGlnAspProSerGlyCysGlyAspAspSerArgMetLysGlyG 30009 : CCTCTCAGGTTTTCACAAGACCCTTCCGGCTGTGGGGATGACAGCCGGatgaagggag : 29950 368 : heAsnPheSerGlnGluTyrLeuPheGlnGluGln{Ty} >>>> Target Intro : 379 ...:::... ! !:::!! !|||||||||{ } 7215 bp lyGlyTrpGlyThrValTrpValSerGlnGluGln{Th}++ 29949 : gaggctggggcacTGTTTGGGTGAGCCAGGAGCAG{AC}gt................. : 29910 380 : n 20 >>>> {r}LeuSerLysAspLeuThrProAlaValThrAspAsnAspGluAl : 394 { }||||||.....!||| ! !|||:!!|||! ! !!::!!|| ++{r}LeuSerSerSerLeuGlnTrpAlaIleThrAla***GluLysAl 29909 : .........ag{G}CTCAGCTCCAGCCTCCAGTGGGCGATTACAGCCTGAGAGAAGGC : 22654 395 : aAsp{L} >>>> Target Intron 21 >>>> {ys}LysAlaGlyGlnAlaTh : 402 |...{:} 20385 bp {!!}|||||||||::! ! ! aSer{G}++ ++{ln}LysAlaGlyArgGlnPr 22653 : GTCA{C}gt..........................ag{AG}AAGGCGGGCAGGCAGCC : 2245 403 : rGluGlyHisCysProArg{Gl} >>>> Target Intron 22 >>>> {n}Gl : 410 !! !!!.. ! |||! !{!:} 1090 bp {!}.. oAlaArgArgArgProPro{Ar}++ +-{g}Se 2244 : TGCTCGGCGGCGGCCTCCA{CG}gt..........................at{G}TC : 1131 411 : nTrpAlaLeuValGluPheGluLysProValThrCysProArgLeuCysLeuValIle : 429 .||||||! !:!!.!. !:!! ! ! !! ! !! !! !:!!|||||| ! ! rTrpAlaSerLeuAsnHisLysAspGlnGlyProThrSerPheValCysLeuHisPro 1130 : CTGGGCCTCTCTGAATCATAAAGACCAGGGCCCAACGTCCTTCGTGTGTCTGCACCCT : 1074 430 : GlySerArgLeuAspAlaAspIle : 437 ||| !!|||||| !.!|||:!! GlyProArgLeuLeuGlyAspLeu 1073 : GGGCCCAGGCTCCTGGGAGATCTT : 1048 vulgar: SPP00000038_1.0 10 437 . NIVO01001699.1:subseq(3461309,210250) 206772 1047 - 116 M 42 126 S 0 2 5 0 2 I 0 5981 3 0 2 S 1 1 M 5 15 S 0 1 5 0 2 I 0 15869 3 0 2 S 1 2 M 10 30 5 0 2 I 0 27841 3 0 2 M 7 21 5 0 2 I 0 26287 3 0 2 M 19 57 5 0 2 I 0 19347 3 0 2 M 27 81 5 0 2 I 0 1721 3 0 2 M 14 42 S 0 2 5 0 2 I 0 10198 3 0 2 S 1 1 M 15 45 S 0 2 5 0 2 I 0 1170 3 0 2 S 1 1 M 8 24 5 0 2 I 0 9172 3 0 2 M 7 21 S 0 2 5 0 2 I 0 7782 3 0 2 S 1 1 M 14 42 S 0 1 5 0 2 I 0 3630 3 0 2 S 1 2 M 4 12 S 0 1 5 0 2 I 0 8740 3 0 2 S 1 2 M 3 9 S 0 1 5 0 2 I 0 2063 3 0 2 S 1 2 M 15 45 S 0 2 5 0 2 I 0 19599 3 0 2 S 1 1 M 12 36 S 0 1 5 0 2 I 0 3276 3 0 2 S 1 2 M 31 93 S 0 1 5 0 2 I 0 3787 3 0 2 S 1 2 M 33 99 5 0 2 I 0 6354 3 0 2 M 46 138 S 0 1 5 0 2 I 0 715 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 2146 3 0 2 S 1 2 M 34 102 S 0 2 5 0 2 I 0 7211 3 0 2 S 1 1 M 16 48 S 0 1 5 0 2 I 0 20381 3 0 2 S 1 2 M 12 36 S 0 2 5 0 2 I 0 1086 3 0 2 S 1 1 M 28 84 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 1048 206772 116 - . gene_id 3 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 206645 206772 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 206645 206772 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 206643 206644 . - . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 200660 206644 . - . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 200660 200661 . - . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 200643 200659 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 200643 200659 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 200641 200642 . - . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 184770 200642 . - . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 184770 184771 . - . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 184738 184769 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 184738 184769 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 184736 184737 . - . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 156893 184737 . - . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 156893 156894 . - . intron_id 2 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 156872 156892 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 156872 156892 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 156870 156871 . - . intron_id 4 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 130581 156871 . - . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 130581 130582 . - . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 130524 130580 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 130524 130580 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 130522 130523 . - . intron_id 5 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 111173 130523 . - . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 111173 111174 . - . intron_id 4 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 111092 111172 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 111092 111172 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 111090 111091 . - . intron_id 6 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 109367 111091 . - . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 109367 109368 . - . intron_id 5 ; splice_site "ac" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 109323 109366 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 109323 109366 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 109321 109322 . - . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 99121 109322 . - . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 99121 99122 . - . intron_id 6 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 99073 99120 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 99073 99120 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 99071 99072 . - . intron_id 8 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 97899 99072 . - . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 97899 97900 . - . intron_id 7 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 97874 97898 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 97874 97898 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 97872 97873 . - . intron_id 9 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 88698 97873 . - . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 88698 88699 . - . intron_id 8 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 88675 88697 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 88675 88697 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 88673 88674 . - . intron_id 10 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 80889 88674 . - . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 80889 80890 . - . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 80845 80888 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 80845 80888 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 80843 80844 . - . intron_id 11 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 77211 80844 . - . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 77211 77212 . - . intron_id 10 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 77196 77210 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 77196 77210 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 77194 77195 . - . intron_id 12 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 68452 77195 . - . intron_id 12 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 68452 68453 . - . intron_id 11 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 68440 68451 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 68440 68451 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 68438 68439 . - . intron_id 13 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 66373 68439 . - . intron_id 13 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 66373 66374 . - . intron_id 12 ; splice_site "CG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 66324 66372 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 66324 66372 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 66322 66323 . - . intron_id 14 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 46721 66323 . - . intron_id 14 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 46721 46722 . - . intron_id 13 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 46683 46720 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 46683 46720 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 46681 46682 . - . intron_id 15 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 43403 46682 . - . intron_id 15 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 43403 43404 . - . intron_id 14 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 43307 43402 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 43307 43402 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 43305 43306 . - . intron_id 16 ; splice_site "AT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 39516 43306 . - . intron_id 16 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 39516 39517 . - . intron_id 15 ; splice_site "TG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 39415 39515 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 39415 39515 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 39413 39414 . - . intron_id 17 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 33057 39414 . - . intron_id 17 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 33057 33058 . - . intron_id 16 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 32918 33056 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 32918 33056 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 32916 32917 . - . intron_id 18 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 32199 32917 . - . intron_id 18 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 32199 32200 . - . intron_id 17 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 32169 32198 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 32169 32198 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 32167 32168 . - . intron_id 19 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 30019 32168 . - . intron_id 19 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 30019 30020 . - . intron_id 18 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 29913 30018 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 29913 30018 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 29911 29912 . - . intron_id 20 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 22698 29912 . - . intron_id 20 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 22698 22699 . - . intron_id 19 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 22648 22697 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 22648 22697 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 22646 22647 . - . intron_id 21 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 2263 22647 . - . intron_id 21 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 2263 2264 . - . intron_id 20 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 2223 2262 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 2223 2262 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 2221 2222 . - . intron_id 22 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 1133 2222 . - . intron_id 22 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 1133 1134 . - . intron_id 21 ; splice_site "AT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 1048 1132 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 1048 1132 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 1048 206772 116 - . alignment_id 3 ; Query SPP00000038_1.0 ; Align 206773 11 126 ; Align 200659 54 15 ; Align 184768 60 30 ; Align 156893 70 21 ; Align 130581 77 57 ; Align 111173 96 81 ; Align 109367 123 42 ; Align 99120 138 45 ; Align 97898 154 24 ; Align 88698 162 21 ; Align 80888 170 42 ; Align 77209 185 12 ; Align 68450 190 9 ; Align 66371 194 45 ; Align 46720 210 36 ; Align 43401 223 93 ; Align 39514 255 99 ; Align 33057 288 138 ; Align 32197 335 27 ; Align 30017 345 102 ; Align 22697 380 48 ; Align 2261 397 36 ; Align 1132 410 84 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 102 Query range: 10 -> 203 Target range: 100816 -> 6009 11 : GlyValLeuGlyHisIleAspSerGlyLysThrAlaLeuAlaArgAlaLeuSerThrT : 30 |||:!!! !|||||| !:!!|||:::||| ! !|||! !.!! !:!!!:!| GlyIleSerGlyHisSerThrAlaGlyArgThrLeuArgAlaLeuThrGlyAlaSerT 100816 : GGCATCTCTGGTCACTCGACTGCCGGACGCACCCTCAGGGCACTGACTGGGGCAAGCA : 100759 31 : hrAlaSerThrAlaAlaPheAspLysGlnProGlnSerArgGluArg{Gl} >>>> : 46 || !..!||| !||| !!:!:! !|||!!.!!!! !:!!..!{||} hrTrpGluThrPheAlaGlnGluArgTrpProHisCysProGlnGlu{Gl}++ 100758 : CGTGGGAGACGTTTGCTCAGGAAAGATGGCCACACTGTCCACAGGAG{GG}gt..... : 100707 47 : Target Intron 1 >>>> {y}IleThrLeuAspLeuGlyPheSerCysPheSer : 57 11980 bp {|}:!:|||! ! !||| !|||!!!|||! :!! -+{y}ValThrSerArgLeuLeuPheCysCysSerAla 100706 : ....................gg{T}GTGACCTCTCGTTTACTGTTCTGCTGCTCAGCG : 88698 58 : ValProLeuProAlaArgLeuArgSerSerLeuProGluPheGlnAlaAla >>>> : 75 !|||||||||||| ! ! !!!!!..!:!! !!! .!.|||:!! ! ProProLeuProAlaAlaGluGlyCysGluValAlaAlaLeuGlnSerLeu++ 88697 : CCTCCCCTGCCTGCAGCAGAGGGGTGTGAAGTCGCAGCCCTGCAGTCTCTCgt..... : 88642 76 : Target Intron 2 >>>> ProGlu{A} >>>> Target Intron 3 >>>> : 77 10868 bp |||! !{|} 735 bp ++ProAla{A}++ 88641 : ....................agCCAGCA{G}gt......................... : 77767 78 : {la}GluProGluProGlyGluProLeuLeuGlnVal{T} >>>> Target In : 89 {||} !! !! !|||||| !||| ! !||| !{|} 5486 ++{la}GlyGlnGlyProGlyLeuProGlyAlaGlnGln{T}++ 77766 : ag{ct}ggACAGGGGCCAGGACTGCCTGGCGCACAGCAG{A}gt.............. : 76996 90 : tron 4 >>>> {hr}LeuValAspCysProGlyHisAlaSerLeuIleArgThrIl : 103 bp {||}! !!.!|||! ! !|||||| !.!!! !:!!! !|||! -+{hr}SerAlaAspSerGluGlyHisArgGlyProValProThrSe 76995 : ...........gg{CA}TCTGCTGACTCTGAAGGCCATCGGGGGCCGGTCCCCACAAG : 71471 104 : eIleGlyGlyAlaGlnIleIleAspLeuMetMetLeuValIleAspValThrLysGly : 122 ! !||| ! !!!!. :!: ||| !:!:|||||| ! !!.!.!!:!! ! rAlaGlyProProHisGlyLeuArgLeuTrpLeuLeuValSerCysAlaAlaGluThr 71470 : TGCTGGCCCCCCGCATGGGTTGCGGCTCTGGCTTCTTGTGTCCTGTGCTGCAGAAACA : 71414 123 : MetGlnThrGlnSerAla >>>> Target Intron 5 >>>> GluCysLeuVa : 132 ! !! ! !!:!!||| ! 19980 bp ||| || ArgLeuProGluSerGln++ ++AlaCysGlyVa 71413 : AGGCTGCCAGAGAGCCAGgt.........................aggcatgtggggt : 51404 133 : lIle{G} >>>> Target Intron 6 >>>> {ly}GlnIleAlaCysGlnLys : 140 | {|} 5488 bp {||}|||:!! !!...|||!.. lGly{G}++ ++{ly}GlnValProAlaGlnSer 51403 : gggg{g}gt.........................ag{GG}CAGGTCCCAGCGCAGAGC : 45892 141 : LeuValValValLeuAsnLysIleAsp{L} >>>> Target Intron 7 >>>> : 150 !||| !|||! !... !!!: { } 20381 bp GlyValTrpValArgGlyTrpMetPro{A}++ + 45891 : GGGGTCTGGGTGCGCGGGTGGATGCCG{G}gt.........................a : 25482 151 : {eu}LeuProGluGlyLysArgGlnAlaAlaIleAspLysMetThrLysLysMetGl : 168 { !} ! !:!!|||::: !||| !::! !!: !..!:!! !:!! ! +{la}ArgGlyGlnGlyArgPheGlnArgSerGlyGluTrpGlnSerPheArgThrGl 25481 : g{ca}cgTGGGCAAGGCCGTTTTCAGCGGAGTGGGGAGTGGCAGTCCTTCAGGACGGG : 25427 169 : nLysThrLeuGluAsnThrLysPheArgGlyAla >>>> Target Intron 8 > : 180 ! !:!!...|||!:!! .!.||||||||| 9976 bp yProTyrIleSerAsnSerThrLeuArgGlyAla++ 25426 : TCCATACATTTCCAACAGCACCCTGAGAGGCGCGgt...................... : 25389 181 : >>> >>>> Target Intron 9 >>>> ProIleIleProValAlaAlaLys : 187 9334 bp !!! ! ! !|||! !... ++++ ++AlaSerTrpGluGlnAlaGluSer 25388 : ...aggt.........................agGCCAGCTGGGAACAGGCAGAATCC : 6060 188 : ProGlyGlyProGluAlaProGluThrGluAlaProGlnGlyIlePro : 203 ||||||!.!||||||:!!|||:!! !! ||| !!!!...!.!!||| ProGlyAlaProGluSerProGlnGluAlaAlaAlaHisSerPhePro 6059 : CCAGGGGCCCCGGAGTCTCCCCAAGAGGCCGCTGCCCACTCCTTTCCC : 6010 vulgar: SPP00000038_1.0 10 203 . NIVO01001699.1:subseq(3461309,210250) 100816 6009 - 102 M 35 105 S 0 2 5 0 2 I 0 11976 3 0 2 S 1 1 M 28 84 5 0 2 I 0 10864 3 0 2 M 2 6 S 0 1 5 0 2 I 0 731 3 0 2 S 1 2 M 11 33 S 0 1 5 0 2 I 0 5482 3 0 2 S 1 2 M 39 117 5 0 2 I 0 19976 3 0 2 M 5 15 S 0 1 5 0 2 I 0 5484 3 0 2 S 1 2 M 15 45 S 0 1 5 0 2 I 0 20377 3 0 2 S 1 2 M 29 87 5 0 2 I 0 9972 3 0 2 5 0 2 I 0 9330 3 0 2 M 24 72 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 6010 100816 102 - . gene_id 4 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 100710 100816 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 100710 100816 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 100708 100709 . - . intron_id 1 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 88730 100709 . - . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 88730 88731 . - . intron_id 0 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 88645 88729 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 88645 88729 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 88643 88644 . - . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 77777 88644 . - . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 77777 77778 . - . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 77770 77776 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 77770 77776 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 77768 77769 . - . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 77035 77769 . - . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 77035 77036 . - . intron_id 2 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 76999 77034 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 76999 77034 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 76997 76998 . - . intron_id 4 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 71513 76998 . - . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 71513 71514 . - . intron_id 3 ; splice_site "GG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 71394 71512 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 71394 71512 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 71392 71393 . - . intron_id 5 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 51414 71393 . - . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 51414 51415 . - . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 51398 51413 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 51398 51413 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 51396 51397 . - . intron_id 6 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 45910 51397 . - . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 45910 45911 . - . intron_id 5 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 45862 45909 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 45862 45909 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 45860 45861 . - . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 25481 45861 . - . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 25481 25482 . - . intron_id 6 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 25392 25480 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 25392 25480 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 25390 25391 . - . intron_id 8 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 15416 25391 . - . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 15416 15417 . - . intron_id 7 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 15414 15415 . - . intron_id 9 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 6082 15415 . - . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 6082 6083 . - . intron_id 8 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 6010 6081 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 6010 6081 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 6010 100816 102 - . alignment_id 4 ; Query SPP00000038_1.0 ; Align 100817 11 105 ; Align 88729 47 84 ; Align 77777 75 6 ; Align 77033 78 33 ; Align 71511 90 117 ; Align 51414 129 15 ; Align 45908 135 45 ; Align 25479 151 87 ; Align 6082 180 72 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000038_1.0 # Protein # Eukaryotic elongation factor (eEFSec) # Homo sapiens # Complete Target: NIVO01001699.1:subseq(3461309,210250) Ammotragus lervia isolate NAZ scaffold1294_len4820224_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 100 Query range: 145 -> 311 Target range: 191249 -> 8243 146 : AsnLysIleAspLeuLeuProGluGlyLys{A} >>>> Target Intron 1 >> : 156 :!! :!! |||||||||... |||{|} 10475 bp HisAlaValIleLeuLeuProHisLeuLys{A}++ 191249 : CATGCTGTCATcctgcttcctcatctgaaa{a}gt....................... : 191216 157 : >> {rg}GlnAlaAlaIleAspLysMetThrLysLysMetGlnLysThrLeuGluAs : 173 {||}!!. ! !!|||..!||| ! !:::!!:!:!:!! !|||:!!|| ++{rg}HisIleProIleSerLysHisTrpProArgIleArgGluLeuLeuLysAs 191215 : ..ag{GA}CATATCCCAATTTCCAAACACTGGCCACGCATTCGAGAGTTATTGAAAAA : 180693 174 : nThr{Ly} >>>> Target Intron 2 >>>> {s}PheArgGlyAlaProIle : 181 ||||{ } 2855 bp {!} !|||!.!::!||| nThr{Va}++ ++{l}AlaArgAlaSerProGln 180692 : CACT{GT}gt.........................ag{G}GCTCGCGCCAGCCCCCAG : 177814 182 : IleProValAlaAlaLysProGlyGlyProGluAlaPro{Gl} >>>> Target I : 195 ||| !:!!||| ! ! ! ! !! !:!!||||||{!!} 196 AlaProHisSerAlaHisArgProArgGluGlnAlaPro{As}++ 177813 : GCGCCGCACTCGGCCCACCGCCCACGTGAGCAGGCACCC{GA}gt............. : 177768 196 : ntron 3 >>>> {u}ThrGluAlaProGlnGlyIleProGlu >>>> Target : 205 bp {:}|||..!!.!||| ! !|||:!! 205 ++{p}ThrSerGlyProAlaProGlyProGln++ 177767 : ............ag{C}ACTTCAGGCCCAGCTCCCGGCCCTCAGgt............ : 177544 206 : Intron 4 >>>> LeuIleGluLeuLeuThrSerGlnIleSerIleProThrArgA : 219 61 bp :!!:!: ||||||..!.!! :!: !:!! !! !!!!! ++ValLeuProLeuLeuValGlyCysLeuHisLeuAlaProSerA 177543 : .............agGTTTTGCCTCTGCTTGTTGGCTGTCTGCATTTAGCGCCGAGCA : 156943 220 : spProSerGlyProPheLeuMetSerVal{As} >>>> Target Intron 5 >> : 229 ||| !!|||||| ! ! !!!..!{ } 11112 bp rgProArgGlyProSerArgGlyThrThr{Ar}+- 156942 : GGCCGCGTGGCCCAAGCAGAGGTACCACA{CG}ga....................... : 156909 230 : >> {p}HisCysPheSerIleLysGlyGlnGlyThrValMetThr >>>> Targe : 243 {!}||| !|||:!! |||||||||!.! ! ! ! 1 ++{g}HisThrPheAlaGlnProGlyGlnGlyAsnArgAlaGln++ 156908 : ..ag{C}CACACCTTCGCACAGCCCGGGCAGGGGAACAGGGCGCAGgt.......... : 145757 244 : t Intron 6 >>>> GlyThrIleLeuSer{G} >>>> Target Intron 7 : 248 1308 bp ||||||:!!! !|||{|} 613 bp -+GlyThrLeuProSer{G}++ 145756 : ...............tgggGACCCTTCCTTCT{G}gt..................... : 134433 249 : >>>> {ly}SerIleSerLeuGlyAsp{Se} >>>> Target Intron 8 >>> : 255 {||}!!! !|||||||||..!{||} 32372 bp ++{ly}ArgCysSerLeuGlySer{Se}++ 134432 : ....ag{GA}AGGTGCTCCCTGGGCAGC{AG}gt........................ : 133798 256 : > {r}ValGluIleProAlaLeuLysValValLysLysValLysSerMetGlnMetP : 273 {|}:!!||| |||::: ::: ||| !:!!:!:|||:!:! -+{r}LeuGluAlaProSerProProProGlyArgGlyValGlyAlaValGlnLeuC 133797 : .tg{C}CTGGaggcccccagccctcctcctggcCGTGGTGTGGGAGCCGTCCAGCTCT : 101376 274 : heHis >>>> Target Intron 9 >>>> MetProIleThrSerAlaMetGln : 282 ! ! 49941 bp |||:!! !!!!!!..||| ysLys++ ++AlaProLeuProThrGlyMetTrp 101375 : GCAAGgt.........................aggCCCCGCTCCCCACAGgcatgtgg : 51408 283 : GlyAspArgLeuGlyIleCysVal >>>> Target Intron 10 >>>> ThrG : 292 ||| |||:!! !:!! 35937 bp :!!! GlyGlyGlySerGlyValLeuLeu++ ++SerA 51407 : ggtggggggtcaggGGTCCTCCTGgt..........................agTCCC : 15441 293 : lnPheAspProLysLeuLeuGlu{Ar} >>>> Target Intron 11 >>>> { : 300 :: !...|||...||| {||} 7138 bp { rgGlySerProSerLeuProPro{Ar}++ ++{ 15440 : GTGGCtcaccttcccttcctccc{ag}gt..........................ag{ : 8277 301 : g}GlyLeuValCysAlaProGluSerLeuHisThr : 311 |}|||:!!!.! ||||||:!!! ! !|||:!! g}GlyValAlaValAlaProGlnLeuThrHisSer 8276 : A}GGGGTGGCCGTGGCCCCGCAGTTGACGCACTCC : 8244 vulgar: SPP00000038_1.0 145 311 . NIVO01001699.1:subseq(3461309,210250) 191249 8243 - 100 M 10 30 S 0 1 5 0 2 I 0 10471 3 0 2 S 1 2 M 18 54 S 0 2 5 0 2 I 0 2851 3 0 2 S 1 1 M 19 57 S 0 2 5 0 2 I 0 192 3 0 2 S 1 1 M 9 27 5 0 2 I 0 20557 3 0 2 M 24 72 S 0 2 5 0 2 I 0 11108 3 0 2 S 1 1 M 13 39 5 0 2 I 0 11304 3 0 2 M 5 15 S 0 1 5 0 2 I 0 609 3 0 2 S 1 2 M 6 18 S 0 2 5 0 2 I 0 32368 3 0 2 S 1 1 M 19 57 5 0 2 I 0 49937 3 0 2 M 16 48 5 0 2 I 0 35933 3 0 2 M 9 27 S 0 2 5 0 2 I 0 7134 3 0 2 S 1 1 M 11 33 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-16 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local gene 8244 191249 100 - . gene_id 5 ; sequence SPP00000038_1.0 ; gene_orientation + NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 191219 191249 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 191219 191249 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 191217 191218 . - . intron_id 1 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 180744 191218 . - . intron_id 1 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 180744 180745 . - . intron_id 0 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 180686 180743 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 180686 180743 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 180684 180685 . - . intron_id 2 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 177831 180685 . - . intron_id 2 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 177831 177832 . - . intron_id 1 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 177771 177830 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 177771 177830 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 177769 177770 . - . intron_id 3 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 177575 177770 . - . intron_id 3 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 177575 177576 . - . intron_id 2 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 177547 177574 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 177547 177574 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 177545 177546 . - . intron_id 4 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 156986 177546 . - . intron_id 4 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 156986 156987 . - . intron_id 3 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 156912 156985 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 156912 156985 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 156910 156911 . - . intron_id 5 ; splice_site "GA" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 145800 156911 . - . intron_id 5 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 145800 145801 . - . intron_id 4 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 145760 145799 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 145760 145799 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 145758 145759 . - . intron_id 6 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 134452 145759 . - . intron_id 6 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 134452 134453 . - . intron_id 5 ; splice_site "tg" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 134436 134451 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 134436 134451 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 134434 134435 . - . intron_id 7 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 133823 134435 . - . intron_id 7 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 133823 133824 . - . intron_id 6 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 133801 133822 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 133801 133822 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 133799 133800 . - . intron_id 8 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 101429 133800 . - . intron_id 8 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 101429 101430 . - . intron_id 7 ; splice_site "TG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 101371 101428 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 101371 101428 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 101369 101370 . - . intron_id 9 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 51430 101370 . - . intron_id 9 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 51430 51431 . - . intron_id 8 ; splice_site "ag" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 51382 51429 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 51382 51429 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 51380 51381 . - . intron_id 10 ; splice_site "GT" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 15445 51381 . - . intron_id 10 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 15445 15446 . - . intron_id 9 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 15416 15444 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 15416 15444 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice5 15414 15415 . - . intron_id 11 ; splice_site "gt" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local intron 8278 15415 . - . intron_id 11 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local splice3 8278 8279 . - . intron_id 10 ; splice_site "AG" NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local cds 8244 8277 . - . NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local exon 8244 8277 . - . insertions 0 ; deletions 0 NIVO01001699.1:subseq(3461309,210250) exonerate:protein2genome:local similarity 8244 191249 100 - . alignment_id 5 ; Query SPP00000038_1.0 ; Align 191250 146 30 ; Align 180742 157 54 ; Align 177830 176 57 ; Align 177574 196 27 ; Align 156986 205 72 ; Align 145799 230 39 ; Align 134452 243 15 ; Align 133821 249 18 ; Align 101428 256 57 ; Align 51430 275 48 ; Align 15445 291 27 ; Align 8277 301 33 # --- END OF GFF DUMP --- # -- completed exonerate analysis