Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q ../SelR3-human.fa -t SelR3-NIVO01040223.1.subseq] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000023_1.0 # Protein # Methionine-R-sufoxide reductase 3 (SelR3) # Homo sapiens # Complete Target: NIVO01040223.1:subseq(1504612,221756) Ammotragus lervia isolate NAZ scaffold2320_len1942639_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 786 Query range: 12 -> 192 Target range: 9536 -> 171756 13 : LeuCysLeuSerLeuCysLeuCysLeu{C} >>>> Target Intron 1 >>>> : 22 ||||||! ! !||||||||||||:!!{ } 20737 bp LeuCysCysHisLeuCysLeuCysVal{H}++ + 9537 : ttatgTTGCCACCTTTGCCTTTGTGTA{C}gt.........................a : 30300 23 : {ys}LeuAlaAlaAlaLeuGlySerAlaGlnSer{G} >>>> Target Intron : 33 { !}||| ! ! ! ||| ||||||{|} 19657 bp +{is}LeuGlnIleIleAlaGlyArgArgGlnSer{G}++ 30301 : g{AT}TTGCAAATAATTGCtggaagaaggcaaagt{g}gt.................. : 30337 34 : 2 >>>> {ly}SerCysArgAspLysLysAsnCysLysValValPheSerGlnGln : 48 {||}||||||||||||||||||||||||||||||||||||||||||:!! ++{ly}SerCysArgAspLysLysAsnCysLysValValPheSerGlnGlu 30338 : .......ag{GG}TCATGTAGGGATAAAAAGAACTGTAAGGTGGTCTTTTCCCAGGAG : 50036 49 : GluLeuArgLysArgLeuThrProLeuGlnTyrHisValThrGlnGluLysGlyThrG : 68 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GluLeuArgLysArgLeuThrProLeuGlnTyrHisValThrGlnGluLysGlyThrG 50037 : GAACTGAGGAAGCGGCTAACACCCCTGCAATACCATGTCACTCAGGAGAAAGGGACCG : 50096 69 : lu{Se} >>>> Target Intron 3 >>>> {r}AlaPheGluGlyGluTyrTh : 76 ||{||} 1614 bp {|}|||||||||||||||||||| lu{Se}++ ++{r}AlaPheGluGlyGluTyrTh 50097 : AA{AG}gt.........................ag{T}GCCTTCGAAGGAGAATATAC : 51734 77 : rHisHisLysAspProGlyIleTyrLysCysValValCysGlyThrProLeuPhe{Ly : 95 |||||||||||||||||||||||||||||||||||||||||||||||||||||||{|| rHisHisLysAspProGlyIleTyrLysCysValValCysGlyThrProLeuPhe{Ly 51735 : ACATCACAAAGATCCTGGAATATACAAATGTGTTGTTTGTGGAACTCCATTGTTT{AA : 51791 96 : } >>>> Target Intron 4 >>>> {s}SerGluThrLysPheAspSerGlyS : 104 } 44702 bp {|}||||||||||||||||||||||||| }++ ++{s}SerGluThrLysPheAspSerGlyS 51792 : }gt.........................ag{G}TCAGAAACCAAATTTGACTCCGGTT : 96520 105 : er{G} >>>> Target Intron 5 >>>> {ly}TrpProSerPheHisAspVa : 112 ||{|} 65162 bp {||}|||||||||||||||||||| er{G}++ ++{ly}TrpProSerPheHisAspVa 96521 : CA{G}gt.........................ag{GC}TGGCCTTCATTCCACGACGT : 161706 113 : lIleAsnSerGluAlaIleThrPheThrAspAspPheSerTyrGlyMetHisArgVal : 131 ||||||||||!!:|||:!:||||||||||||||||||||||||||||||||||||||| lIleAsnSerAspAlaValThrPheThrAspAspPheSerTyrGlyMetHisArgVal 161707 : GATCAATTCTGATGCGGTGACATTCACAGATGACTTTTCCTATGGGATGCACAGGGTG : 161763 132 : GluThrSerCysSerGln >>>> Target Intron 6 >>>> CysGlyAlaHi : 141 |||||||||||||||||| 9811 bp ||||||||||| GluThrSerCysSerGln++ ++CysGlyAlaHi 161764 : GAGACCAGCTGCTCTCAGgt.........................agTGCGGTGCTCA : 171604 142 : sLeuGlyHisIlePheAspAspGlyProArgProThrGlyLysArgTyrCysIleAsn : 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| sLeuGlyHisIlePheAspAspGlyProArgProThrGlyLysArgTyrCysIleAsn 171605 : CCTCGGGCACATTTTCGACGACGGACCTCGTCCAACCGGCAAAAGATACTGCATAAAC : 171661 161 : SerAlaAlaLeuSerPheThrProAlaAspSerSerGlyThrAlaGluGlyGlySerG : 180 ||||||:!!|||||||||||| !!|||!!:||||||||| !!:!!|||! !|||! SerAlaSerLeuSerPheThrAlaAlaGluSerSerGly---ProGlnGlyAspSerA 171662 : TCGGCATCCTTGTCTTTCACCGCTGCAGAGAGCAGTGGC---CCCCAGGGGGACAGTG : 171718 181 : lyValAlaSerProAlaGlnAlaAspLysAlaGluLeu : 192 .!! !!.!|||||||||! !.!||||||.!!|||||| laGlyGlySerProAlaProGlyAspLysThrGluLeu 171719 : CGGGGGGCAGCCCGGCCCCTGGTGACAAGACGGAGCTG : 171756 vulgar: SPP00000023_1.0 12 192 . NIVO01040223.1:subseq(1504612,221756) 9536 171756 + 786 M 9 27 S 0 1 5 0 2 I 0 20733 3 0 2 S 1 2 M 10 30 S 0 1 5 0 2 I 0 19653 3 0 2 S 1 2 M 35 105 S 0 2 5 0 2 I 0 1610 3 0 2 S 1 1 M 25 75 S 0 2 5 0 2 I 0 44698 3 0 2 S 1 1 M 9 27 S 0 1 5 0 2 I 0 65158 3 0 2 S 1 2 M 32 96 5 0 2 I 0 9807 3 0 2 M 36 108 G 1 0 M 18 54 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local gene 9537 171756 786 + . gene_id 1 ; sequence SPP00000023_1.0 ; gene_orientation + NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 9537 9564 . + . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 9537 9564 . + . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 9565 9566 . + . intron_id 1 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 9565 30301 . + . intron_id 1 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 30300 30301 . + . intron_id 0 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 30302 30334 . + . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 30302 30334 . + . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 30335 30336 . + . intron_id 2 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 30335 49991 . + . intron_id 2 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 49990 49991 . + . intron_id 1 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 49992 50100 . + . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 49992 50100 . + . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 50101 50102 . + . intron_id 3 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 50101 51714 . + . intron_id 3 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 51713 51714 . + . intron_id 2 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 51715 51792 . + . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 51715 51792 . + . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 51793 51794 . + . intron_id 4 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 51793 96494 . + . intron_id 4 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 96493 96494 . + . intron_id 3 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 96495 96523 . + . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 96495 96523 . + . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 96524 96525 . + . intron_id 5 ; splice_site "Gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 96524 161685 . + . intron_id 5 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 161684 161685 . + . intron_id 4 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 161686 161783 . + . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 161686 161783 . + . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 161784 161785 . + . intron_id 6 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 161784 171594 . + . intron_id 6 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 171593 171594 . + . intron_id 5 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 171595 171756 . + . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 171595 171756 . + . insertions 0 ; deletions 1 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local similarity 9537 171756 786 + . alignment_id 1 ; Query SPP00000023_1.0 ; Align 9537 13 27 ; Align 30304 23 30 ; Align 49994 34 105 ; Align 51716 70 75 ; Align 96496 96 27 ; Align 161688 106 96 ; Align 171595 138 108 ; Align 171703 175 54 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000023_1.0 # Protein # Methionine-R-sufoxide reductase 3 (SelR3) # Homo sapiens # Complete Target: NIVO01040223.1:subseq(1504612,221756) Ammotragus lervia isolate NAZ scaffold2320_len1942639_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 102 Query range: 8 -> 136 Target range: 211212 -> 21618 9 : ArgProLeuSerLeuCysLeuSerLeuCysLeuCysLeuCysLeu{Al} >>>> Ta : 24 !:!|||:!!!.! ! !||||||:!!|||||| !|||||||||{..} LysProMetLysGluThrLeuSerIleCysLeuThrLeuCysLeu{Cy}++ 211212 : AAACCGATGAAGGAAACCTTATCTATATGTCTAACTCTATGTCTG{TG}gt....... : 211163 25 : rget Intron 1 >>>> {a}AlaAlaLeuGlySerAlaGlnSerGlySerCysAr : 36 35968 bp {!}.!! !:!! !!!!::! !!!||||||||||| ++{s}ThrLysIleHisThrSerCys***GlySerCysAr 211162 : ..................ag{C}ACAAAAATACATACAAGCTGCTGAGGATCCTGCAG : 175163 37 : g{A} >>>> Target Intron 2 >>>> {sp}LysLysAsnCysLysValVal : 44 |{|} 23747 bp {||}||||||||| |||::: ! g{A}++ -+{sp}LysLysAsnThrLysIleAsn 175162 : A{G}gt.........................tg{at}aaaaaaaataccaaaattaaT : 151392 45 : >>>> Target Intron 3 >>>> PheSerGlnGlnGluLeuArgLysArgLe : 54 37811 bp ...:::...:::::: !|||!!!|| ++ ++AlaGlnLysHisLysIleIleLysSerLe 151391 : gt.........................aggcacagaaacacaaaataatCAAAAGCCT : 113551 55 : uThrProLeuGlnTyrHisValThrGlnGluLysGlyThrGluSer{Al} >>>> T : 70 |:!!|||||| ! ..!! !:!!:!!! !|||!:!..!..!{ } uSerProLeuAlaLeuLeuThrIleLysGlnThrGlySerArgGlu{Ar}++ 113550 : CTCCCCCTTGGCTTTGTTAACTATAAAACAAACAGGTAGCAGAGAG{AG}gt...... : 113499 71 : arget Intron 4 >>>> {a}PheGluGlyGluTyrThrHisHisLysAspProG : 82 38209 bp {!} ..!:!! .!!||||||!:!! ! !!| ++{g}AlaIleSerLysArgAlaHisHisArgGlyThrG 113498 : ...................ag{A}GCAATCTCAAAGAGGGCACACCACAGAGGTACTG : 75258 83 : lyIleTyrLysCysVal{V} >>>> Target Intron 5 >>>> {al}CysGl : 90 ||:!! !! !|||:!!{ } 10175 bp { !} !.. lyValAsnLeuCysLeu{T}++ ++{rp}TyrSe 75257 : GAGTTAATTTATGCTTA{T}gt.........................ag{gg}taTTC : 65059 91 : yThrProLeuPheLysSerGluThrLysPheAspSerGlySerGly >>>> Targe : 106 !||| !||| ! ! ! ..! !::|||...|||...||| 3 rThrIleLeuGlyIleIlePheValCysTyrAspGlyGlyGluGly++ 65058 : GACAATTCTTGGAATTATATTTGTTTGTTAtgatggtggggagggggt.......... : 65009 107 : t Intron 6 >>>> TrpProSerPhe >>>> Target Intron 7 >>>> : 110 1627 bp |||! ! 11673 bp ++GlnProPheGln++ ++ 65008 : ...............agCAACCCTTTCAGgt.........................ag : 21701 111 : HisAspValIleAsnSerGluAlaIleThrPheThrAspAspPheSerTyrGlyMetH : 129 ... ::::::... ||||||:::|||::: |||||| GluArgIleLeuGluTrpValAlaIleSerPheSerArgGlyPheSerGlnProArgA 21700 : gaaaggatactggaatgggttgccatatccttctccaggggattttcccaacccaggg : 21642 130 : isArgValGluThrSerCysSer : 136 |||.........||||||::: spArgThrArgValSerCysThr 21641 : atcgaacccgggtttcctgcact : 21619 vulgar: SPP00000023_1.0 8 136 . NIVO01040223.1:subseq(1504612,221756) 211212 21618 - 102 M 15 45 S 0 2 5 0 2 I 0 35964 3 0 2 S 1 1 M 12 36 S 0 1 5 0 2 I 0 23743 3 0 2 S 1 2 M 7 21 5 0 2 I 0 37807 3 0 2 M 25 75 S 0 2 5 0 2 I 0 38205 3 0 2 S 1 1 M 17 51 S 0 1 5 0 2 I 0 10171 3 0 2 S 1 2 M 17 51 5 0 2 I 0 31623 3 0 2 M 4 12 5 0 2 I 0 11669 3 0 2 M 27 81 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local gene 21619 211212 102 - . gene_id 1 ; sequence SPP00000023_1.0 ; gene_orientation + NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 211166 211212 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 211166 211212 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 211164 211165 . - . intron_id 1 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 175198 211165 . - . intron_id 1 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 175198 175199 . - . intron_id 0 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 175160 175197 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 175160 175197 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 175158 175159 . - . intron_id 2 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 151413 175159 . - . intron_id 2 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 151413 151414 . - . intron_id 1 ; splice_site "tg" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 151390 151412 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 151390 151412 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 151388 151389 . - . intron_id 3 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 113579 151389 . - . intron_id 3 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 113579 113580 . - . intron_id 2 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 113502 113578 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 113502 113578 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 113500 113501 . - . intron_id 4 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 75293 113501 . - . intron_id 4 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 75293 75294 . - . intron_id 3 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 75240 75292 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 75240 75292 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 75238 75239 . - . intron_id 5 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 65065 75239 . - . intron_id 5 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 65065 65066 . - . intron_id 4 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 65012 65064 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 65012 65064 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 65010 65011 . - . intron_id 6 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 33385 65011 . - . intron_id 6 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 33385 33386 . - . intron_id 5 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 33373 33384 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 33373 33384 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 33371 33372 . - . intron_id 7 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 21700 33372 . - . intron_id 7 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 21700 21701 . - . intron_id 6 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 21619 21699 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 21619 21699 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local similarity 21619 211212 102 - . alignment_id 1 ; Query SPP00000023_1.0 ; Align 211213 9 45 ; Align 175197 25 36 ; Align 151411 38 21 ; Align 113579 45 75 ; Align 75292 71 51 ; Align 65063 89 51 ; Align 33385 106 12 ; Align 21700 110 81 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000023_1.0 # Protein # Methionine-R-sufoxide reductase 3 (SelR3) # Homo sapiens # Complete Target: NIVO01040223.1:subseq(1504612,221756) Ammotragus lervia isolate NAZ scaffold2320_len1942639_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 100 Query range: 4 -> 176 Target range: 211212 -> 13326 5 : ArgThrLeuProArgProLeuSerLeuCysLeuSerLeuCysLeu{Cy} >>>> Ta : 20 !:! !!:!! !..! !!||||||:!!||||||!!!|||||||||{||} LysProMetLysGluThrLeuSerIleCysLeuThrLeuCysLeu{Cy}++ 211212 : AAACCGATGAAGGAAACCTTATCTATATGTCTAACTCTATGTCTG{TG}gt....... : 211163 21 : rget Intron 1 >>>> {s}LeuCysLeuAlaAlaAlaLeuGlySerAlaGlnSe : 32 3903 bp {|} |||||| ...... ||| :: ++{s}SerCysLeuTrpGlyCysThrGluSerAspThrTh 211162 : ..................ag{c}tcctgtctatggggttgcacagagtcggacacgac : 207228 33 : rGlySerCysArgAspLysLysAsnCysLysValValPheSerGlnGlnGluLeuArg : 51 : ... .........::: |||:::...|||::::::...::: ::: rGluGlnLeuSerSerSerSerSerSerLysLeuThrPheAsnGluSerLysArgLys 207227 : tgaacaacttagcagcagcagcagcagcaaactcacatttaatgaaagtaaaaggaaa : 207171 52 : LysArgLeu >>>> Target Intron 2 >>>> ThrProLeuGlnTyrHisVa : 61 1259 bp ...||||||... ... HisValTyr++ ++AlaProLeuSerMetGluPh 207170 : catgtatatgt.........................aggctcctctgtccatggaatt : 205882 62 : lThr{Gl} >>>> Target Intron 3 >>>> {n}GluLysGlyThrGluSer : 69 :::{::} 20933 bp {!}||| !||||||:!! ! eSer{Ar}++ ++{g}GluProGlyThrGlnLeu 205881 : ttcc{ag}gt.........................ag{A}GAACCAGGAACCCAACTG : 184925 70 : Ala >>>> Target Intron 4 >>>> PheGluGlyGluTyrThrHisHisLy : 79 ||| 2852 bp |||...||| |||... .. Ala++ ++PheHisGlyLeuTyrAsnSerPheAs 184924 : GCCgt.........................agttccatggactatacaattcgttcaa : 182043 80 : sAspPro{G} >>>> Target Intron 5 >>>> {ly}IleTyrLys{C} > : 86 ....|||{!} 337 bp { !}:::||||||{|} nSerPro{V}++ ++{al}ValTyrLys{C}++ 182042 : ttctcca{g}gt.........................ag{tc}gtatacaaa{t}gt. : 181682 87 : >>> Target Intron 6 >>>> {ys}ValValCysGlyThrProLeuPheLysS : 96 24580 bp {||} !:!!||| !!! ! !||| !:!!! ++{ys}LysLeuCysArgLysArgLeuHisGlnL 181681 : ........................ag{GC}AAGCTCTGTAGAAAGAGACTCCATCAGA : 157075 97 : er{G} >>>> Target Intron 7 >>>> {lu}ThrLysPheAspSerGlySe : 104 .!{|} 30546 bp {||}... ...|||...|||:: ys{G}++ -+{lu}AsnProMetAspGlyGlyAl 157074 : AA{G}gt.........................gg{aa}aatcccatggacggaggagc : 126505 105 : rGlyTrpProSerPheHisAspValIleAsnSerGluAlaIleThrPheThrAspAsp : 123 : ||| ::: ||| ||| ...|||:::... aTrpTrpAlaAlaValHisGlyValAlaLysSerGlnThrArgLeuSerAspPheThr 126504 : ctggtgggctgcagtccatggggtcgctaagagtcagacacgactcagtgacttcact : 126448 124 : PheSerTyrGlyMetHisArgValGluThrSerCys >>>> Target Intron 8 : 136 |||:::::: ...||| :::||| ... 26583 bp PheThrPheHisPheHisAlaLeuGluLysGluMet+- 126447 : ttcacttttcactttcatgcattggagaaagaaatggc.................... : 126407 137 : >>>> SerGlnCysGlyAlaHisLeuGly{Hi} >>>> Target Intron 9 : 144 !||| !:!!! !||||||{..} 39068 bp ++HisGlnLeuThrSerLeuLeuGly{Ar}++ 126406 : .....agCATCAACTAACTTCCCTTcttggg{ag}gt..................... : 99798 145 : >>>> {s}IlePheAspAspGlyProArgPro{Th} >>>> Target Intron : 153 {.} |||||||||||| {! } 25110 bp ++{g}HisPheAspAspGlyArgSerAsp{Ar}++ 99797 : ....ag{a}cattttgatgatggccggtctgac{ag}gt................... : 60703 154 : 10 >>>> {r}GlyLysArgTyrCysIleAsnSerAla{Al} >>>> Target I : 163 {!}..! !! !||||||||||||:!! { } 218 ++{g}AsnLeuProTyrCysIleAsnAlaIle{As}++ 60702 : .......ag{A}AATCTACCATATTGTATCAATGCAATa{aa}gt............. : 35563 164 : ntron 11 >>>> {a}LeuSerPhe{Th} >>>> Target Intron 12 >>> : 167 1 bp {!} ! !!|||{!:} 20018 bp ++{n}AsnProPhe{Se}++ 35562 : .............ag{C}AACCCTTTC{AG}gt......................... : 33370 168 : > {r}ProAlaAspSerSerGlyThrAlaGlu : 176 {!}||| ||||||... ::::::::: ++{r}ProLysAspSerGlnGluSerSerGln 33369 : .ag{t}ccaaaggactcacaagagtcttctcaa : 13327 vulgar: SPP00000023_1.0 4 176 . NIVO01040223.1:subseq(1504612,221756) 211212 13326 - 100 M 15 45 S 0 2 5 0 2 I 0 3899 3 0 2 S 1 1 M 34 102 5 0 2 I 0 1255 3 0 2 M 8 24 S 0 2 5 0 2 I 0 20929 3 0 2 S 1 1 M 7 21 5 0 2 I 0 2848 3 0 2 M 11 33 S 0 1 5 0 2 I 0 333 3 0 2 S 1 2 M 3 9 S 0 1 5 0 2 I 0 24576 3 0 2 S 1 2 M 10 30 S 0 1 5 0 2 I 0 30542 3 0 2 S 1 2 M 38 114 5 0 2 I 0 26579 3 0 2 M 8 24 S 0 2 5 0 2 I 0 39064 3 0 2 S 1 1 M 8 24 S 0 2 5 0 2 I 0 25106 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 2177 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 20014 3 0 2 S 1 1 M 9 27 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local gene 13327 211212 100 - . gene_id 2 ; sequence SPP00000023_1.0 ; gene_orientation + NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 211166 211212 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 211166 211212 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 211164 211165 . - . intron_id 1 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 207263 211165 . - . intron_id 1 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 207263 207264 . - . intron_id 0 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 207160 207262 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 207160 207262 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 207158 207159 . - . intron_id 2 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 205901 207159 . - . intron_id 2 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 205901 205902 . - . intron_id 1 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 205875 205900 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 205875 205900 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 205873 205874 . - . intron_id 3 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 184942 205874 . - . intron_id 3 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 184942 184943 . - . intron_id 2 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 184920 184941 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 184920 184941 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 184918 184919 . - . intron_id 4 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 182068 184919 . - . intron_id 4 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 182068 182069 . - . intron_id 3 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 182034 182067 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 182034 182067 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 182032 182033 . - . intron_id 5 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 181697 182033 . - . intron_id 5 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 181697 181698 . - . intron_id 4 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 181685 181696 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 181685 181696 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 181683 181684 . - . intron_id 6 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 157105 181684 . - . intron_id 6 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 157105 157106 . - . intron_id 5 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 157072 157104 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 157072 157104 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 157070 157071 . - . intron_id 7 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 126526 157071 . - . intron_id 7 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 126526 126527 . - . intron_id 6 ; splice_site "gg" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 126410 126525 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 126410 126525 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 126408 126409 . - . intron_id 8 ; splice_site "gc" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 99827 126409 . - . intron_id 8 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 99827 99828 . - . intron_id 7 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 99801 99826 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 99801 99826 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 99799 99800 . - . intron_id 9 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 60733 99800 . - . intron_id 9 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 60733 60734 . - . intron_id 8 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 60706 60732 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 60706 60732 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 60704 60705 . - . intron_id 10 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 35596 60705 . - . intron_id 10 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 35596 35597 . - . intron_id 9 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 35566 35595 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 35566 35595 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 35564 35565 . - . intron_id 11 ; splice_site "gt" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 33385 35565 . - . intron_id 11 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 33385 33386 . - . intron_id 10 ; splice_site "AG" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 33373 33384 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 33373 33384 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice5 33371 33372 . - . intron_id 12 ; splice_site "GT" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local intron 13355 33372 . - . intron_id 12 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local splice3 13355 13356 . - . intron_id 11 ; splice_site "ag" NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local cds 13327 13354 . - . NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local exon 13327 13354 . - . insertions 0 ; deletions 0 NIVO01040223.1:subseq(1504612,221756) exonerate:protein2genome:local similarity 13327 211212 100 - . alignment_id 2 ; Query SPP00000023_1.0 ; Align 211213 5 45 ; Align 207262 21 102 ; Align 205901 55 24 ; Align 184941 64 21 ; Align 182068 71 33 ; Align 181695 83 9 ; Align 157103 87 30 ; Align 126524 98 114 ; Align 99827 136 24 ; Align 60732 145 24 ; Align 35595 154 27 ; Align 33384 164 9 ; Align 13354 168 27 # --- END OF GFF DUMP --- # -- completed exonerate analysis