Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q ../GPx2-human.fa -t GPx2-NIVO01055543.1.subseq] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 130 Query range: 1 -> 184 Target range: 77658 -> 847754 2 : AlaPheIleAlaLysSerPheTyrAspLeu >>>> Target Intron 1 >>>> : 12 .!!|||:!: !|||||||||||||||! ! 13023 bp ThrPheLeu***LysSerPheTyrAspHis++ + 77659 : aCATTCTTGTAGAAGTCTTTTTATGATCATgt.........................a : 90710 13 : >>>> Target Intron 2 >>>> SerAlaIleSerLeuAspGlyGluLysV : 21 64317 bp ! !::!! ||| !||||||||||||| +++ ++LeuSerLysSerAlaAspGlyGluLysV 90711 : ggt.........................agTTGAGTAAGTCAGCTGATGGAGAGAAAG : 155056 22 : alAspPheAsnThrPheArg{Gl} >>>> Target Intron 3 >>>> {y} : 29 || !||| ! !!{||} 32585 bp {|} alArgAlaProThrSerGly{Gl}++ ++{y}++ 155057 : TGAGGGCACCTACCAGTGGG{GG}gt.........................ag{G}gt : 187665 30 : >>>> Target Intron 4 >>>> ArgAlaValLeuIleGluAsnValAlaSerL : 39 2665 bp !.! |||::::::...:::::: | ++HisTyrCysLeuLeuLysArgLeuSerPheL 187666 : .........................agCATTactgtttgttgaaaaggctatcttttc : 190360 40 : euUnkGlyThrThrThrArgAspPheThrGlnLeuAsnGluLeuGlnCys >>>> T : 56 || |||||| ! !! !!!.:!! !:!!||| !||| ||| euHisTrpThrThrLeuSerAlaLeuSerIleIleAsn***LeuThrCys++ 190361 : tccactggACGACTCTATCAGCTTTGTCCATAATCAATTGACTTACgtgtgt...... : 190413 57 : arget Intron 5 >>>> {A} >>>> Target Intron 6 >>>> {rg}P : 57 14453 bp {!} 21384 bp {:!}| ++{L}++ ++{ys}P 190414 : ...................ag{A}gt.........................ag{aa}t : 226251 58 : heProArgArgLeu{V} >>>> Target Intron 7 >>>> {al}ValLeuGl : 65 |||||!:!|||:::{:} 49074 bp {!!} ||||| heProGlnArgIle{L}++ +-{eu}PheLeuGl 226252 : tcccACAGAgaata{t}gt.........................aa{ta}ttcttggg : 275349 66 : yPheProCysAsnGlnPhe{G} >>>> Target Intron 8 >>>> {ly}His : 73 ||||||||||...... {|} 59151 bp {||}||| yPheProCysGlySerThr{G}++ ++{ly}His 275350 : cttcccttgtggctcaact{g}gt.........................ag{GG}CAC : 334524 74 : Gln{Gl} >>>> Target Intron 9 >>>> {u}AsnCys{G} >>>> Tar : 78 |||{..} 80802 bp {!}||||||{.} Gln{Ar}++ ++{g}AsnCys{A}++ 334525 : CAG{AG}gt.........................ag{A}AATTGC{A}gt........ : 415344 79 : get Intron 10 >>>> {ln}AsnGluGluIleLeuAsnSerLeuLysTyrValA : 90 57968 bp {!.}||| !|||! |||!:!..!|||! !!:!!! ++{sn}AsnThrGluLysLeuSerAspLeuIleAsnIleG 415345 : ..................ag{AC}AACACAGAAAAGCTAAGCGATTTGATTAACATAC : 473345 91 : rgProGlyGlyGlyTyrGlnProThrPheThrLeuValGlnLysCysGluVal{As} : 108 :!|||||| !|||! ::! ! !.!! !!!! !.!.:!! ! !{!.} lnProGlyIleGlySerArgLysCysIleLeuPheHisAspGluThrLeuGly{Ar}+ 473346 : AGCCAGGAATAGGCTCAAGAAAATGTATTCTGTTTCATGATGAAACACTCGGT{AG}g : 473401 109 : >>>> Target Intron 11 >>>> {n}GlyGln{A} >>>> Target Int : 111 28705 bp {.}|||:!!{.} 7706 + ++{g}GlyLys{G}++ 473402 : t..........................ag{A}GGGAAA{G}gt............... : 502116 112 : ron 12 >>>> {sn}GluHisProValPheAlaTyrLeuLys{A} >>>> Targ : 121 bp {!.} ...||| |||::: ||| {|} ++{lu}MetGluProGluPheSerAlaLeuAla{A}++ 502117 : ...........ag{aa}atggaacctgagttttctgcattggca{g}gt......... : 509852 122 : et Intron 13 >>>> {sp}LysLeuProTyrProTyrAspAspPro{Ph} >> : 131 54697 bp {||} !!:!!|||:!!||| !|||{ } ++{sp}***ValProHisProLeuProThrPro{Se}++ 509853 : .................ag{AT}TAGGTTCCTCATCCCCTACCAACTCCC{AG}gt.. : 564580 132 : >> Target Intron 14 >>>> {e}SerLeuMetThrAspProLysLeuIleIl : 141 88980 bp {!}!!!! ! |||!!:|||:!! !:!!|| ++{r}ThrTyrSerThrGluProGlnAsnValIl 564581 : ........................ag{C}ACATATTCAACTGAGCCACAAAATGTCAT : 653586 142 : eTrpSerPro >>>> Target Intron 15 >>>> ValArgArgSerAspVal : 150 | !!!! ! 28901 bp |||||||||...|||::: eLysThrGln++ ++ValArgArgGlyAspLeu 653587 : CAAAACGCAGgt..........................aggtcaggaggggcgacctc : 682514 151 : AlaTrp{A} >>>> Target Intron 16 >>>> {sn}PheGlu{Ly} >>> : 156 ... {.} 147487 bp {..}|||...{!:} ValGln{G}++ ++{ly}PheSer{Ar}++ 682515 : gtccaa{g}gt..........................ag{ga}ttttcc{ag}gt... : 830023 157 : > Target Intron 17 >>>> {s}PheLeuIleGlyProGluGlyGluProPhe : 166 2321 bp {!}!!.|||:!!..! ! ! !:!!|||||| ++{g}LeuLeuValSer***IleLysGlnProPhe 830024 : .......................ag{G}TTGCTGGTCTCCTGAATAAAGCAACCTTTC : 832370 167 : ArgArgTyrSerArg >>>> Target Intron 18 >>>> ThrPheProThrI : 176 ||| !|||..!!.! 15328 bp !.!!!. !|||: ArgSerTyrGlnHis-+ ++AsnLeuGlyThrV 832371 : CGTTCCTACCAGCACtt..........................agAATTTAGGGACAG : 847728 177 : leAsnIleGluProAspIleLysArg : 184 !!!:!!!:.!.|||...||||||||| alSerMetAsnProSerIleLysArg 847729 : TCAGTATGAACccctcaataaaaaga : 847754 vulgar: SPP00000005_1.0 1 184 . NIVO01055543.1 77658 847754 + 130 M 10 30 5 0 2 I 0 13019 3 0 2 5 0 2 I 0 64313 3 0 2 M 16 48 S 0 2 5 0 2 I 0 32581 3 0 2 S 1 1 5 0 2 I 0 2661 3 0 2 M 27 81 5 0 2 I 0 14449 3 0 2 S 0 1 5 0 2 I 0 21380 3 0 2 S 1 2 M 5 15 S 0 1 5 0 2 I 0 49070 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 59147 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 80798 3 0 2 S 1 1 M 2 6 S 0 1 5 0 2 I 0 57964 3 0 2 S 1 2 M 29 87 S 0 2 5 0 2 I 0 28701 3 0 2 S 1 1 M 2 6 S 0 1 5 0 2 I 0 7702 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 54693 3 0 2 S 1 2 M 9 27 S 0 2 5 0 2 I 0 88976 3 0 2 S 1 1 M 13 39 5 0 2 I 0 28897 3 0 2 M 8 24 S 0 1 5 0 2 I 0 147483 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 2317 3 0 2 S 1 1 M 15 45 5 0 2 I 0 15324 3 0 2 M 13 39 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 77659 847754 130 + . gene_id 1 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 77659 77688 . + . NIVO01055543.1 exonerate:protein2genome:local exon 77659 77688 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 77689 77690 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 77689 90711 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 90710 90711 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 90712 90713 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 90712 155028 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 155027 155028 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 155029 155078 . + . NIVO01055543.1 exonerate:protein2genome:local exon 155029 155078 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 155079 155080 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 155079 187663 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 187662 187663 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 187664 187664 . + . NIVO01055543.1 exonerate:protein2genome:local exon 187664 187664 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 187665 187666 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 187665 190329 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 190328 190329 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 190330 190410 . + . NIVO01055543.1 exonerate:protein2genome:local exon 190330 190410 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 190411 190412 . + . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 190411 204863 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 204862 204863 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 204864 204864 . + . NIVO01055543.1 exonerate:protein2genome:local exon 204864 204864 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 204865 204866 . + . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 204865 226248 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 226247 226248 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 226249 226266 . + . NIVO01055543.1 exonerate:protein2genome:local exon 226249 226266 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 226267 226268 . + . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 226267 275340 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 275339 275340 . + . intron_id 6 ; splice_site "aa" NIVO01055543.1 exonerate:protein2genome:local cds 275341 275370 . + . NIVO01055543.1 exonerate:protein2genome:local exon 275341 275370 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 275371 275372 . + . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 275371 334521 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 334520 334521 . + . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 334522 334531 . + . NIVO01055543.1 exonerate:protein2genome:local exon 334522 334531 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 334532 334533 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 334532 415333 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 415332 415333 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 415334 415341 . + . NIVO01055543.1 exonerate:protein2genome:local exon 415334 415341 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 415342 415343 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 415342 473309 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 473308 473309 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 473310 473400 . + . NIVO01055543.1 exonerate:protein2genome:local exon 473310 473400 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 473401 473402 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 473401 502105 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 502104 502105 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 502106 502113 . + . NIVO01055543.1 exonerate:protein2genome:local exon 502106 502113 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 502114 502115 . + . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 502114 509819 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 509818 509819 . + . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 509820 509849 . + . NIVO01055543.1 exonerate:protein2genome:local exon 509820 509849 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 509850 509851 . + . intron_id 13 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 509850 564546 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 564545 564546 . + . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 564547 564577 . + . NIVO01055543.1 exonerate:protein2genome:local exon 564547 564577 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 564578 564579 . + . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 564578 653557 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 653556 653557 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 653558 653597 . + . NIVO01055543.1 exonerate:protein2genome:local exon 653558 653597 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 653598 653599 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 653598 682498 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 682497 682498 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 682499 682523 . + . NIVO01055543.1 exonerate:protein2genome:local exon 682499 682523 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 682524 682525 . + . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 682524 830010 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 830009 830010 . + . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 830011 830020 . + . NIVO01055543.1 exonerate:protein2genome:local exon 830011 830020 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 830021 830022 . + . intron_id 17 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 830021 832341 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 832340 832341 . + . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 832342 832387 . + . NIVO01055543.1 exonerate:protein2genome:local exon 832342 832387 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 832388 832389 . + . intron_id 18 ; splice_site "TT" NIVO01055543.1 exonerate:protein2genome:local intron 832388 847715 . + . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 847714 847715 . + . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 847716 847754 . + . NIVO01055543.1 exonerate:protein2genome:local exon 847716 847754 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 77659 847754 130 + . alignment_id 1 ; Query SPP00000005_1.0 ; Align 77659 2 30 ; Align 155029 12 48 ; Align 190330 29 81 ; Align 226251 57 15 ; Align 275343 63 27 ; Align 334524 73 6 ; Align 415335 76 6 ; Align 473312 79 87 ; Align 502107 109 6 ; Align 509822 112 27 ; Align 564549 122 27 ; Align 653559 132 39 ; Align 682499 145 24 ; Align 830013 154 6 ; Align 832343 157 45 ; Align 847716 172 39 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 128 Query range: 6 -> 180 Target range: 14549 -> 1191498 7 : SerPheTyrAspLeuSerAlaIleSerLeu >>>> Target Intron 1 >>> : 17 |||... ||||||!!!! !||||||||| 76132 bp SerMetArgAspLeuThrAspIleSerLeu++ 14550 : tcaatGAGAGATCTGACAGACATTAGCCTGgt........................ : 14582 18 : > >>>> Target Intron 2 >>>> AspGlyGluLysValAsp >>>> : 23 18902 bp ||||||! :!!|||||| ++++ +-AspGlyGlyGluValAsp++ 14583 : .aggt.........................acGATGGAGGTGAGGTGGACgt.... : 109634 24 : Target Intron 3 >>>> PheAsnThrPheArgGlyArgAlaValLeuIle : 33 162582 bp !!.|||||||||.!! !|||:!!:!!! ! ++LysLysThrPheArgSerLeuAlaIleIleThr 109635 : .....................agAAGAAAACCTTCAGAAGTTTAGCAATTATAACA : 272244 34 : GluAsnVal{A} >>>> Target Intron 4 >>>> {la}SerLeuUnkGl : 41 !!:! ! !{|} 55151 bp {||}||||||... AspIleTyr{A}++ ++{la}SerLeuSerLe 272245 : GATATTTAT{G}gt.........................ag{cc}tctctttctct : 327419 42 : yThrThrThrArgAspPheThr{G} >>>> Target Intron 5 >>>> {l : 49 :::..!! !! ||||||{:} 81443 bp {! uCysSerValIleAlaPheThr{L}++ ++{y 327420 : ctgctctgtAATTGCATTCACT{A}gt.........................ag{A : 408887 50 : n}LeuAsn{G} >>>> Target Intron 6 >>>> {lu}LeuGlnCysArg : 56 !}:!!|||{|} 100924 bp {||}:::::: ... s}IleAsn{G}++ ++{lu}MetGluProGlu 408888 : A}ATCAAC{G}gt.........................ag{aa}atggaacctgag : 509831 57 : PheProArgArgLeu{V} >>>> Target Intron 7 >>>> {al}ValLe : 64 ||| {|} 417 bp {||} || PheSerAlaLeuAla{V}++ ++{al}PheLe 509832 : ttttctgcattggca{g}gt.........................ag{ta}ttctt : 510272 65 : uGlyPheProCysAsnGlnPhe{G} >>>> Target Intron 8 >>>> {l : 72 |||||||||| ...... {|} 115831 bp {| uGlyPheProGlyGlySerVal{G}++ ++{l 510273 : gggcttccctggtggctcagtt{g}gt.........................ag{G : 626128 73 : y}HisGlnGlu >>>> Target Intron 9 >>>> AsnCysGlnAsnGluG : 81 |}|||..!||| 110196 bp !:!|||:!!!:!.!. y}HisMetGlu++ ++SerCysLysSerHisT 626129 : G}CACATGGAGgt.........................agAGTTGTAAGAGTCATA : 736350 82 : luIleLeu{A} >>>> Target Intron 10 >>>> {sn}SerLeuLysTy : 88 ||||||{!} 37139 bp {..}|||! ! hrIleLeu{T}++ ++{hr}SerSerGlyLe 736351 : CTATATTA{A}gt..........................ag{CG}AGTTCAGGCCT : 773510 89 : rValArgProGlyGly{G} >>>> Target Intron 11 >>>> {ly}Tyr : 95 ! ! !||||||{|} 27644 bp {||}!:! uLysSerLeuGlyGly{G}++ ++{ly}Phe 773511 : AAAGTCATTAGGTGGA{G}gt..........................ag{GT}TTT : 801175 96 : GlnProThrPheThrLeuValGlnLysCysGlu{V} >>>> Target Intron : 107 .!. !|||! ! !|||:!!!!.!:!||||||{|} 47301 bp AsnLysThr***LysLeuIleHisArgCysGlu{V}+- 801176 : AATAAAACCTGAAAGCTTATTCATAGGTGTGAA{G}ga.................. : 801214 108 : 12 >>>> {al}{As} >>>> Target Intron 13 >>>> {n}{Gl} : 109 {||}{||} 9227 bp {|}{.!} ++{al}{As}++ ++{n}{Se}+ 801215 : ........ag{TG}{AA}gt..........................ag{T}{AG}g : 857747 110 : >>>> Target Intron 14 >>>> {y}GlnAsnGluHisProValPheAla : 117 5796 bp {!}! ::!.!. !|||! !|||:!! + ++{r}LeuSerAsnPheProGluPheSer 857748 : t..........................ag{C}CTCTCTAACTTCCCCGAATTTTCT : 863565 118 : Tyr >>>> Target Intron 15 >>>> LeuLysAsp{Ly} >>>> Tar : 122 ||| 50702 bp ::: |||{!:} Tyr++ ++ValLeuAsp{Ar}++ 863566 : TATgt..........................aggttcttGAC{AG}gt........ : 914286 123 : get Intron 16 >>>> {s}LeuProTyrProTyrAspAspPro{P} >>>> : 131 28145 bp {!}||||||:::|||:::|||...|||{ } ++{g}LeuProHisProTrpAspSerPro{G}+- 914287 : ..................ag{g}ctcccccatccctgggattctcca{g}gc.... : 942457 132 : Target Intron 17 >>>> {he}SerLeuMet >>>> Target Intro : 135 31849 bp { } !!|||||| 100397 b ++{ly}ProLeuMet++ 942458 : ......................ag{GA}CCACTTATGgt................. : 974317 136 : n 18 >>>> ThrAspProLysLeuIleIleTrpSerProValArg{Ar} >>> : 147 p ::: |||...:::|||::: |||||| {!:} ++SerAlaProSerValIleLeuLysSerProLysIle{Ly}++ 974318 : .........agtcagcaccttcagtgattttgaagtcccccaaaata{aa}gt... : 1074752 148 : > Target Intron 19 >>>> {g}SerAspValAlaTrp >>>> Target : 153 67404 bp {!}:!! ! :!!!.!||| 12 ++{s}AlaLysLeuGlyTrp++ 1074753 : .......................ag{a}GCCAAGCTTGGGTGGgt........... : 1142172 154 : Intron 20 >>>> AsnPheGluLysPheLeuIleGlyPro{G} >>>> Ta : 162 641 bp ::: ...||||||:::||||||{|} ++SerHisCysSerPheLeuLeuGlyPro{G}++ 1142173 : ...............agagtcactgctcctttctcctgggtcct{g}gt....... : 1154841 163 : rget Intron 21 >>>> {lu}Gly >>>> Target Intron 22 >>>> : 164 19962 bp {||}||| 16642 bp ++{lu}Gly++ 1154842 : ...................ag{AA}GGGgt.......................... : 1174808 165 : GluProPheArgArgTyrSerArgThrPheProThrIleAsnIleGluPro : 180 ! ||| !||| ! :!! !:!!!:!||| !|||||| ! ||| +-AlaProAlaArgAspAlaAlaSerSerTyrProGluIleAsnProProPro 1174809 : acGCTCCTGCCAGGGATGCGGCGTCTTCCTATCCGGAAATCAATCCTCCCCCG : 1191498 vulgar: SPP00000005_1.0 6 180 . NIVO01055543.1 14549 1191498 + 128 M 10 30 5 0 2 I 0 76128 3 0 2 5 0 2 I 0 18898 3 0 2 M 6 18 5 0 2 I 0 162578 3 0 2 M 14 42 S 0 1 5 0 2 I 0 55147 3 0 2 S 1 2 M 11 33 S 0 1 5 0 2 I 0 81439 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 100920 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 413 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 115827 3 0 2 S 1 2 M 3 9 5 0 2 I 0 110192 3 0 2 M 8 24 S 0 1 5 0 2 I 0 37135 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 27640 3 0 2 S 1 2 M 12 36 S 0 1 5 0 2 I 0 47297 3 0 2 S 1 4 5 0 2 I 0 9223 3 0 2 S 1 3 5 0 2 I 0 5792 3 0 2 S 1 1 M 9 27 5 0 2 I 0 50698 3 0 2 M 3 9 S 0 2 5 0 2 I 0 28141 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 31845 3 0 2 S 1 2 M 3 9 5 0 2 I 0 100393 3 0 2 M 12 36 S 0 2 5 0 2 I 0 67400 3 0 2 S 1 1 M 5 15 5 0 2 I 0 12637 3 0 2 M 9 27 S 0 1 5 0 2 I 0 19958 3 0 2 S 1 2 M 1 3 5 0 2 I 0 16638 3 0 2 M 17 51 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 14550 1191498 128 + . gene_id 2 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 14550 14579 . + . NIVO01055543.1 exonerate:protein2genome:local exon 14550 14579 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 14580 14581 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 14580 90711 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 90710 90711 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 90712 90713 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 90712 109613 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 109612 109613 . + . intron_id 1 ; splice_site "AC" NIVO01055543.1 exonerate:protein2genome:local cds 109614 109631 . + . NIVO01055543.1 exonerate:protein2genome:local exon 109614 109631 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 109632 109633 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 109632 272213 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 272212 272213 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 272214 272256 . + . NIVO01055543.1 exonerate:protein2genome:local exon 272214 272256 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 272257 272258 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 272257 327407 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 327406 327407 . + . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 327408 327443 . + . NIVO01055543.1 exonerate:protein2genome:local exon 327408 327443 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 327444 327445 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 327444 408886 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 408885 408886 . + . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 408887 408895 . + . NIVO01055543.1 exonerate:protein2genome:local exon 408887 408895 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 408896 408897 . + . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 408896 509819 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 509818 509819 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 509820 509849 . + . NIVO01055543.1 exonerate:protein2genome:local exon 509820 509849 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 509850 509851 . + . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 509850 510266 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 510265 510266 . + . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 510267 510296 . + . NIVO01055543.1 exonerate:protein2genome:local exon 510267 510296 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 510297 510298 . + . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 510297 626127 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 626126 626127 . + . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 626128 626138 . + . NIVO01055543.1 exonerate:protein2genome:local exon 626128 626138 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 626139 626140 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 626139 736334 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 736333 736334 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 736335 736359 . + . NIVO01055543.1 exonerate:protein2genome:local exon 736335 736359 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 736360 736361 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 736360 773498 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 773497 773498 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 773499 773528 . + . NIVO01055543.1 exonerate:protein2genome:local exon 773499 773528 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 773529 773530 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 773529 801172 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 801171 801172 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 801173 801211 . + . NIVO01055543.1 exonerate:protein2genome:local exon 801173 801211 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 801212 801213 . + . intron_id 12 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 801212 848512 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 848511 848512 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 848513 848516 . + . NIVO01055543.1 exonerate:protein2genome:local exon 848513 848516 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 848517 848518 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 848517 857743 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 857742 857743 . + . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 857744 857746 . + . NIVO01055543.1 exonerate:protein2genome:local exon 857744 857746 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 857747 857748 . + . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 857747 863542 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 863541 863542 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 863543 863570 . + . NIVO01055543.1 exonerate:protein2genome:local exon 863543 863570 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 863571 863572 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 863571 914272 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 914271 914272 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 914273 914283 . + . NIVO01055543.1 exonerate:protein2genome:local exon 914273 914283 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 914284 914285 . + . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 914284 942428 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 942427 942428 . + . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 942429 942454 . + . NIVO01055543.1 exonerate:protein2genome:local exon 942429 942454 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 942455 942456 . + . intron_id 17 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 942455 974303 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 974302 974303 . + . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 974304 974314 . + . NIVO01055543.1 exonerate:protein2genome:local exon 974304 974314 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 974315 974316 . + . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 974315 1074711 . + . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 1074710 1074711 . + . intron_id 17 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1074712 1074749 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1074712 1074749 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1074750 1074751 . + . intron_id 19 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1074750 1142153 . + . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 1142152 1142153 . + . intron_id 18 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1142154 1142169 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1142154 1142169 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1142170 1142171 . + . intron_id 20 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1142170 1154810 . + . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 1154809 1154810 . + . intron_id 19 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1154811 1154838 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1154811 1154838 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1154839 1154840 . + . intron_id 21 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1154839 1174800 . + . intron_id 21 NIVO01055543.1 exonerate:protein2genome:local splice3 1174799 1174800 . + . intron_id 20 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1174801 1174805 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1174801 1174805 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1174806 1174807 . + . intron_id 22 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1174806 1191447 . + . intron_id 22 NIVO01055543.1 exonerate:protein2genome:local splice3 1191446 1191447 . + . intron_id 21 ; splice_site "AC" NIVO01055543.1 exonerate:protein2genome:local cds 1191448 1191498 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1191448 1191498 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 14550 1191498 128 + . alignment_id 2 ; Query SPP00000005_1.0 ; Align 14550 7 30 ; Align 109614 17 18 ; Align 272214 23 42 ; Align 327410 38 33 ; Align 408889 50 6 ; Align 509822 53 27 ; Align 510269 63 27 ; Align 626130 73 9 ; Align 736335 76 24 ; Align 773501 85 27 ; Align 801175 95 36 ; Align 863544 110 27 ; Align 914273 119 9 ; Align 942430 123 24 ; Align 974306 132 9 ; Align 1074712 135 36 ; Align 1142155 148 15 ; Align 1154811 153 27 ; Align 1174803 163 3 ; Align 1191448 164 51 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 117 Query range: 15 -> 189 Target range: 45965 -> 809727 16 : LeuAspGlyGluLysVal{As} >>>> Target Intron 1 >>>> {p}PheA : 24 |||!!:|||.!.||| !{..} 16493 bp {!}|||: LeuGluGlyHisLysAsn{Se}++ ++{r}PheS 45966 : CTGGAGGGACACAAGAAC{AG}gt.........................ag{T}TTTT : 62483 25 : snThrPheArgGlyArgAlaValLeuIleGluAsnValAlaSerLeuUnkGlyThrTh : 43 :!!:! !:!.!!! !:!! !||||||...!..:!! !|||!!! ||| !.. erSerAlaGlnSerThrSerSerLeuIleSerThrLeuAsnSerPheArgGlyCysVa 62484 : CCAGCGCACAGAGCACCTCATCCTTGATCTCCACACTGAACTCCTTTCGGGGATGTGT : 62540 44 : rThr{A} >>>> Target Intron 2 >>>> {rg}AspPheThrGlnLeuAsn : 51 ! !{ } 35741 bp { !}! !.!! !! !||| ! lGlu{A}++ ++{sp}AlaLeu***LeuLeuAla 62541 : TGAA{G}gt.........................ag{AT}GCTCTTTGACTATTAGCT : 98305 52 : GluLeuGlnCysArgPheProArgArgLeuValValLeuGlyPhePro{C} >>>> : 68 :!! !|||! !|||!:!|||!.!! !!!!:!!:!! ! !!!.|||{|} LysArgGlnSerArgTyrProHisLeuPheIleLeuThrProLeuPro{C}++ 98306 : AAAAGGCAGTCTAGATATCCTCACCTGTTTATCCTCACCCCATTGCCC{T}gt..... : 98359 69 : Target Intron 3 >>>> {ys}AsnGlnPhe{G} >>>> Target Intron : 72 19140 bp {||}|||!!..!!{|} 3805 bp ++{ys}AsnHisLeu{G}++ 98360 : ....................ag{GC}AATCATCTT{G}gt.................. : 117511 73 : 4 >>>> {ly}HisGlnGluAsnCysGlnAsnGluGluIleLeuAsnSerLeuLys : 87 {||}||| ||| ::: ||| :::|||::: ++{ly}HisLeuProAsnProArgIleGluProGlySerProAlaLeuGln 117512 : .......ag{gg}catcttcccaacccaaggattgaacccgggtctcctgcattgcag : 121358 88 : >>>> Target Intron 5 >>>> {T} >>>> Target Intron 6 >>> : 88 20636 bp { } 4418 bp ++ ++{V}++ 121359 : gt.........................ag{G}gt........................ : 142000 89 : > {yr}ValArgProGlyGlyGlyTyr{Gl} >>>> Target Intron 7 >>> : 96 { !}:!!|||||| !|||!.! !{::} 132223 bp ++{al}IleArgProHisGlyAlaSer{Ar}++ 142001 : .ag{TC}ATCAGACCGCACGGAGCCAGC{AG}gt........................ : 146443 97 : > {n}ProThrPheThrLeuVal{G} >>>> Target Intron 8 >>>> {l : 103 {!}||| ! !!.!:!!|||{:} 120726 bp {! ++{g}ProLeuSerAsnValVal{G}++ ++{l 146444 : .ag{G}CCTCTGAGTAATGTTGTG{G}gt.........................ag{A : 399410 104 : n}LysCys{G} >>>> Target Intron 9 >>>> {lu}ValAsn{G} >>> : 109 !}!:!|||{|} 9468 bp {||}:!!|||{!} u}ArgCys{G}++ ++{lu}IleAsn{A}++ 399411 : G}AGGTGT{G}gt.........................ag{AA}ATCAAC{G}gt... : 408898 110 : > Target Intron 10 >>>> {ly}GlnAsnGluHis >>>> Target Int : 114 9699 bp {.!}::!||||||||| 56521 ++{la}ArgAsnGluHis-+ 408899 : .......................ag{CT}AGAAATGAGCACtt............... : 418611 115 : ron 11 >>>> ProValPheAlaTyrLeuLys{A} >>>> Target Intron : 121 bp |||..!||| ! !||| !{!} 34650 bp ++ProThrPheHisLeuLeuPro{G}++ 418612 : ...........agcCCACTTTCCATCTTCTTCCA{G}gt................... : 475154 122 : 12 >>>> {sp}LysLeuProTyrProTyrAspAspPro<->PheSerLeuMetThr : 135 { } |||||||||||| :::||| |||||| :::... ++{ly}TyrLeuProTyrProGluMetGluProGluPheSerAlaLeuAla 475155 : .......ag{gg}tatcttccctacccagaaatggaacctgagttttctgcattggca : 509846 136 : {A} >>>> Target Intron 13 >>>> {sp}ProLysLeuIleIleTrpSer : 143 {!} 108178 bp { !}|||:!!||||||:!!|||||| {G}++ ++{ly}ProGlnLeuIleLeuTrpSer 509847 : {g}gt..........................ag{GT}CCTCAATTAATACTTTGGTCA : 618048 144 : {P} >>>> Target Intron 14 >>>> {ro}ValArgArgSerAspValAla : 151 { } 14363 bp { !}:!!!:!|||!.!|||..! ! {M}-- ++{et}IleGlnArgLysAspThrLys 618049 : {A}aa..........................ag{TG}ATACAACGAAAAGATACTAAA : 632435 152 : {Tr} >>>> Target Intron 15 >>>> {p}AsnPheGluLysPheLeuIle : 159 {||} 22847 bp {|}||| :::||| ||| {Tr}++ ++{p}AsnLysLysLysValLeuAsn 632436 : {TG}gt..........................ag{g}aacaaaaaaaaagttttgaat : 655306 160 : >>>> Target Intron 16 >>>> GlyProGluGlyGluProPheArg{Ar} : 168 27189 bp ||| ||||||...||| {||} ++ +-GlyGlnGluGlyArgProArgPro{Ar} 655307 : gt..........................aaggtcaggaggggcgacctcgtcca{ag} : 682522 169 : >>>> Target Intron 17 >>>> {g}TyrSerArgThrPheProThrIleA : 177 89259 bp {|}|||||| ! !||||||.!.:::| ++ ++{g}TyrSerValHisPheProAlaValA 682523 : gt..........................ag{A}TATTCAGTTCATTTTCCAGCtgtaa : 771808 178 : snIleGluProAsp >>>> Target Intron 18 >>>> IleLysArgLeuLe : 186 || 37881 bp :::||||||:::|| snTyrLeuGluLys++ ++ValLysArgValLe 771809 : attatttagaaaaggt..........................aggtgaaaagagttct : 809716 187 : uLysValAla : 189 |::::::::! uGluIleSer 809717 : ggagatcagC : 809727 vulgar: SPP00000005_1.0 15 189 . NIVO01055543.1 45965 809727 + 117 M 6 18 S 0 2 5 0 2 I 0 16489 3 0 2 S 1 1 M 22 66 S 0 1 5 0 2 I 0 35737 3 0 2 S 1 2 M 22 66 S 0 1 5 0 2 I 0 19136 3 0 2 S 1 2 M 3 9 S 0 1 5 0 2 I 0 3801 3 0 2 S 1 2 M 15 45 5 0 2 I 0 20632 3 0 2 S 0 1 5 0 2 I 0 4414 3 0 2 S 1 2 M 7 21 S 0 2 5 0 2 I 0 132219 3 0 2 S 1 1 M 6 18 S 0 1 5 0 2 I 0 120722 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 9464 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 9695 3 0 2 S 1 2 M 4 12 5 0 2 I 0 56517 3 0 2 M 7 21 S 0 1 5 0 2 I 0 34646 3 0 2 S 1 2 M 9 27 G 0 3 M 5 15 S 0 1 5 0 2 I 0 108174 3 0 2 S 1 2 M 7 21 S 0 1 5 0 2 I 0 14359 3 0 2 S 1 2 M 7 21 S 0 2 5 0 2 I 0 22843 3 0 2 S 1 1 M 7 21 5 0 2 I 0 27185 3 0 2 M 8 24 S 0 2 5 0 2 I 0 89255 3 0 2 S 1 1 M 13 39 5 0 2 I 0 37877 3 0 2 M 8 24 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 45966 809727 117 + . gene_id 3 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 45966 45985 . + . NIVO01055543.1 exonerate:protein2genome:local exon 45966 45985 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 45986 45987 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 45986 62478 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 62477 62478 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 62479 62546 . + . NIVO01055543.1 exonerate:protein2genome:local exon 62479 62546 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 62547 62548 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 62547 98287 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 98286 98287 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 98288 98356 . + . NIVO01055543.1 exonerate:protein2genome:local exon 98288 98356 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 98357 98358 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 98357 117496 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 117495 117496 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 117497 117508 . + . NIVO01055543.1 exonerate:protein2genome:local exon 117497 117508 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 117509 117510 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 117509 121313 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 121312 121313 . + . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 121314 121360 . + . NIVO01055543.1 exonerate:protein2genome:local exon 121314 121360 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 121361 121362 . + . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 121361 141996 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 141995 141996 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 141997 141997 . + . NIVO01055543.1 exonerate:protein2genome:local exon 141997 141997 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 141998 141999 . + . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 141998 146415 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 146414 146415 . + . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 146416 146440 . + . NIVO01055543.1 exonerate:protein2genome:local exon 146416 146440 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 146441 146442 . + . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 146441 278663 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 278662 278663 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 278664 278683 . + . NIVO01055543.1 exonerate:protein2genome:local exon 278664 278683 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 278684 278685 . + . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 278684 399409 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 399408 399409 . + . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 399410 399418 . + . NIVO01055543.1 exonerate:protein2genome:local exon 399410 399418 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 399419 399420 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 399419 408886 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 408885 408886 . + . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 408887 408895 . + . NIVO01055543.1 exonerate:protein2genome:local exon 408887 408895 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 408896 408897 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 408896 418594 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 418593 418594 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 418595 418608 . + . NIVO01055543.1 exonerate:protein2genome:local exon 418595 418608 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 418609 418610 . + . intron_id 11 ; splice_site "TT" NIVO01055543.1 exonerate:protein2genome:local intron 418609 475129 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 475128 475129 . + . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 475130 475151 . + . NIVO01055543.1 exonerate:protein2genome:local exon 475130 475151 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 475152 475153 . + . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 475152 509801 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 509800 509801 . + . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 509802 509849 . + . NIVO01055543.1 exonerate:protein2genome:local exon 509802 509849 . + . insertions 3 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 509850 509851 . + . intron_id 13 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 509850 618027 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 618026 618027 . + . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 618028 618051 . + . NIVO01055543.1 exonerate:protein2genome:local exon 618028 618051 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 618052 618053 . + . intron_id 14 ; splice_site "AA" NIVO01055543.1 exonerate:protein2genome:local intron 618052 632414 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 632413 632414 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 632415 632439 . + . NIVO01055543.1 exonerate:protein2genome:local exon 632415 632439 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 632440 632441 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 632440 655286 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 655285 655286 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 655287 655308 . + . NIVO01055543.1 exonerate:protein2genome:local exon 655287 655308 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 655309 655310 . + . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 655309 682497 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 682496 682497 . + . intron_id 15 ; splice_site "aa" NIVO01055543.1 exonerate:protein2genome:local cds 682498 682523 . + . NIVO01055543.1 exonerate:protein2genome:local exon 682498 682523 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 682524 682525 . + . intron_id 17 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 682524 771782 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 771781 771782 . + . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 771783 771822 . + . NIVO01055543.1 exonerate:protein2genome:local exon 771783 771822 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 771823 771824 . + . intron_id 18 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 771823 809703 . + . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 809702 809703 . + . intron_id 17 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 809704 809727 . + . NIVO01055543.1 exonerate:protein2genome:local exon 809704 809727 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 45966 809727 117 + . alignment_id 3 ; Query SPP00000005_1.0 ; Align 45966 16 18 ; Align 62480 23 66 ; Align 98290 46 66 ; Align 117499 69 9 ; Align 121316 73 45 ; Align 146418 89 21 ; Align 278665 97 18 ; Align 399412 104 6 ; Align 408889 107 6 ; Align 418597 110 12 ; Align 475130 114 21 ; Align 509804 122 27 ; Align 509834 131 15 ; Align 618030 137 21 ; Align 632417 145 21 ; Align 655288 153 21 ; Align 682498 160 24 ; Align 771784 169 39 ; Align 809704 182 24 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 117 Query range: 12 -> 165 Target range: 304563 -> 1215474 13 : AlaIleSerLeuAspGlyGluLysValAspPhe >>>> Target Intron 1 : 24 |||:!!|||! !|||||||||!..:!!||| 44551 bp AlaValSerTyrAspGlyGluSerIleAspGln++ 304564 : GCAGTCTCCTATGATGGAGAAAGTATTGACCAGgt..................... : 304599 25 : >>>> AsnThrPheArgGlyArgAlaVal >>>> Target Intron 2 >>> : 32 |||:!! !:!|||||||||:!! 26598 bp ++AsnSerArgLysGlyArgAlaLeu++ 304600 : ....agAACTCAAGGAAAGGGAGGGCTCTAgt........................ : 349174 33 : > LeuIleGluAsnValAlaSerLeuUnkGly >>>> Target Intron 3 : 42 |||:!:|||||||||..!!!!||| !! 33087 bp ++LeuValGluAsnValCysThrLeuAspArg+- 349175 : .agCTAGTGGAGAATGTTTGCACTTTGGACAGGgg..................... : 375802 43 : >>>> ThrThrThr >>>> Target Intron 4 >>>> {Ar} >>>> T : 45 ! !:!!||| 41425 bp {||} ++LysSerThr++ ++{Ar}++ 375803 : ....agAAATCAACGgt.........................ag{AG}gt...... : 450325 46 : arget Intron 5 >>>> {g}AspPheThrGlnLeuAsnGluLeu >>>> T : 54 2927 bp {|}||| ||||||::::::...::: ++{g}AspArgThrGlnValSerHisIle++ 450326 : ...................ag{g}gatcgaacccaggtctcccacattgt...... : 453277 55 : arget Intron 6 >>>> GlnCysArg{Ph} >>>> Target Intron 7 : 57 86632 bp :!!|||!:!{! } 178701 bp ++LysCysLys{Cy}++ 453278 : ...................agAAATGCAAG{TG}gt.................... : 539920 58 : >>>> {e}ProArgArgLeu{V} >>>> Target Intron 8 >>>> {a : 62 {!}|||!:!!.!! !{|} 95775 bp {| ++{s}ProLysHisSer{V}++ ++{a 539921 : .....ag{T}CCTAAACATTCA{G}gt.........................ag{t : 814408 63 : l}ValLeuGlyPheProCysAsnGlnPheGlyHisGlnGluAsnCysGln >>>> : 79 |} ||| |||||||||...... ||| :::... |||... l}PheLeuAspPheProCysGlySerThrGlyLysGluSerAlaCysAsn++ 814409 : a}ttcttggacttcccttgtggctcaactggtaaagaatctgcctgcaatgt.... : 814460 80 : Target Intron 9 >>>> AsnGluGlu{I} >>>> Target Intron : 82 16286 bp |||... {:} 154646 bp ++AsnSerPro{V}+- 814461 : .....................agaattctcca{g}gc................... : 830756 83 : 10 >>>> {le}LeuAsnSerLeuLysTyrValArg >>>> Target Intro : 91 {!:} ! ||||||:!!|||:!!!:! 10896 bp ++{al}ThrLeuSerLeuGlnTyrIleLys++ 830757 : .......ag{TG}ACACTGTCTCTACAGTATATAAAGgt................. : 985428 92 : n 11 >>>> ProGly >>>> Target Intron 12 >>>> GlyGlyTyr : 95 ||| !! 87368 bp ||| ! ++ProArg-+ ++GlyLeuVal 985429 : .........agCCAAGGat..........................agGGGCTGGTG : 1083702 96 : GlnProThrPheThrLeuValGlnLysCysGluValAsnGlyGlnAsnGluHisPr : 114 :!! ! !||| !||| !..!! !|||:!! !.!.||| ! !!:!!||| GluGluCysPheLeuLeuTrpMetThrCysLysProGluGlyAlaTyrGlnHisAs 1083703 : GAGGAGTGTTTTTTGCTTTGGATGACGTGTAAGCCAGAGGGGGCATATCAACATGA : 1083759 115 : oValPheAlaTyrLeu >>>> Target Intron 13 >>>> LysAspLysL : 123 ! !!.!!! ! ||| 34785 bp |||...| pPheIleGluGlyLeu++ ++ValAspSerL 1083760 : TTTCATCGAGGGGCTGgt..........................aggtggattctt : 1118571 124 : euPro{T} >>>> Target Intron 14 >>>> {yr}ProTyrAspAspPr : 130 |||||{ } 35098 bp { !}||||||::: || euPro{V}++ ++{al}ProTyrAsnHisPr 1118572 : tacca{g}gt..........................ag{tc}ccctataatcaccc : 1153690 131 : oPheSerLeu{Me} >>>> Target Intron 15 >>>> {t}ThrAspPro : 137 ||||... {||} 26646 bp {|} ||| oPheGlnSer{Me}-+ ++{t}IleLysPro 1153691 : attccagtcc{at}tt..........................ag{g}atcaaacct : 1180357 138 : LysLeuIleIleTrpSerProValArg{A} >>>> Target Intron 16 >> : 147 |||:!: ::: ::: { } 18721 bp ProLeuLeuThrPheProAlaLeuAla{G}++ 1180358 : ccaTTACTtacgttccctgcattggca{g}gt........................ : 1180390 148 : >> {rg}SerAspValAlaTrpAsn >>>> Target Intron 17 >>>> : 154 {!!}!:!||| !||||||.!. 16310 bp ++{ly}AsnAspHisAlaTrpGln+- ++ 1180391 : ..ag{GA}AATGACCATGCATGGCAGgc..........................ag : 1215437 155 : PheGluLysPheLeuIleGlyProGluGlyGluPro : 165 :::......||| |||:::|||:::||| ValAspSerLeuLeuAlaLysProGlnGlyLysPro 1215438 : gtggattctttactggctaagccacaaggaaagccc : 1215474 vulgar: SPP00000005_1.0 12 165 . NIVO01055543.1 304563 1215474 + 117 M 11 33 5 0 2 I 0 44547 3 0 2 M 8 24 5 0 2 I 0 26594 3 0 2 M 10 30 5 0 2 I 0 33083 3 0 2 M 3 9 5 0 2 I 0 41421 3 0 2 S 0 2 5 0 2 I 0 2923 3 0 2 S 1 1 M 8 24 5 0 2 I 0 86628 3 0 2 M 3 9 S 0 2 5 0 2 I 0 178697 3 0 2 S 1 1 M 4 12 S 0 1 5 0 2 I 0 95771 3 0 2 S 1 2 M 16 48 5 0 2 I 0 16282 3 0 2 M 3 9 S 0 1 5 0 2 I 0 154642 3 0 2 S 1 2 M 8 24 5 0 2 I 0 10892 3 0 2 M 2 6 5 0 2 I 0 87364 3 0 2 M 27 81 5 0 2 I 0 34781 3 0 2 M 5 15 S 0 1 5 0 2 I 0 35094 3 0 2 S 1 2 M 8 24 S 0 2 5 0 2 I 0 26642 3 0 2 S 1 1 M 12 36 S 0 1 5 0 2 I 0 18717 3 0 2 S 1 2 M 6 18 5 0 2 I 0 16306 3 0 2 M 12 36 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 304564 1215474 117 + . gene_id 4 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 304564 304596 . + . NIVO01055543.1 exonerate:protein2genome:local exon 304564 304596 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 304597 304598 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 304597 349147 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 349146 349147 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 349148 349171 . + . NIVO01055543.1 exonerate:protein2genome:local exon 349148 349171 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 349172 349173 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349172 375769 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 375768 375769 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 375770 375799 . + . NIVO01055543.1 exonerate:protein2genome:local exon 375770 375799 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 375800 375801 . + . intron_id 3 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 375800 408886 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 408885 408886 . + . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 408887 408895 . + . NIVO01055543.1 exonerate:protein2genome:local exon 408887 408895 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 408896 408897 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 408896 450320 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 450319 450320 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 450321 450322 . + . NIVO01055543.1 exonerate:protein2genome:local exon 450321 450322 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 450323 450324 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 450323 453249 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 453248 453249 . + . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 453250 453274 . + . NIVO01055543.1 exonerate:protein2genome:local exon 453250 453274 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 453275 453276 . + . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 453275 539906 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 539905 539906 . + . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 539907 539917 . + . NIVO01055543.1 exonerate:protein2genome:local exon 539907 539917 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 539918 539919 . + . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 539918 718618 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 718617 718618 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 718619 718632 . + . NIVO01055543.1 exonerate:protein2genome:local exon 718619 718632 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 718633 718634 . + . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 718633 814407 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 814406 814407 . + . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 814408 814457 . + . NIVO01055543.1 exonerate:protein2genome:local exon 814408 814457 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 814458 814459 . + . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 814458 830743 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 830742 830743 . + . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 830744 830753 . + . NIVO01055543.1 exonerate:protein2genome:local exon 830744 830753 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 830754 830755 . + . intron_id 10 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 830754 985399 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 985398 985399 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 985400 985425 . + . NIVO01055543.1 exonerate:protein2genome:local exon 985400 985425 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 985426 985427 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 985426 996321 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 996320 996321 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 996322 996327 . + . NIVO01055543.1 exonerate:protein2genome:local exon 996322 996327 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 996328 996329 . + . intron_id 12 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 996328 1083695 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 1083694 1083695 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1083696 1083776 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1083696 1083776 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1083777 1083778 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1083777 1118561 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 1118560 1118561 . + . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1118562 1118577 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1118562 1118577 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1118578 1118579 . + . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1118578 1153675 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 1153674 1153675 . + . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1153676 1153703 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1153676 1153703 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1153704 1153705 . + . intron_id 15 ; splice_site "tt" NIVO01055543.1 exonerate:protein2genome:local intron 1153704 1180349 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 1180348 1180349 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1180350 1180387 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1180350 1180387 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1180388 1180389 . + . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1180388 1199108 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 1199107 1199108 . + . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1199109 1199128 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1199109 1199128 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1199129 1199130 . + . intron_id 17 ; splice_site "GC" NIVO01055543.1 exonerate:protein2genome:local intron 1199129 1215438 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 1215437 1215438 . + . intron_id 16 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1215439 1215474 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1215439 1215474 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 304564 1215474 117 + . alignment_id 4 ; Query SPP00000005_1.0 ; Align 304564 13 33 ; Align 349148 24 24 ; Align 375770 32 30 ; Align 408887 42 9 ; Align 453251 46 24 ; Align 539907 54 9 ; Align 718620 58 12 ; Align 814410 63 48 ; Align 830744 79 9 ; Align 985402 83 24 ; Align 996322 91 6 ; Align 1083696 93 81 ; Align 1118562 120 15 ; Align 1153678 126 24 ; Align 1180351 135 36 ; Align 1199111 148 18 ; Align 1215439 154 36 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 114 Query range: 23 -> 188 Target range: 48153 -> 750461 24 : AsnThrPheArgGlyArgAlaValLeuIleGluAsnValAla{Se} >>>> Targe : 38 ||||||!:: !|||||| !|||||| !... !! !{!!} 3 AsnThrTrpAlaGlyArgAsnValLeuProSerAlaPheTyr{Ar}++ 48154 : AACACCTGGGCAGGCAGGAATGTGTTACCCTCCGCATTCTAC{AG}gt.......... : 48200 39 : t Intron 1 >>>> {r}LeuUnkGlyThr{Th} >>>> Target Intron 2 : 43 0056 bp {!} ...|||:::{!:} 9391 bp ++{g}ThrSerGlySer{Se}++ 48201 : ...............ag{g}acgtctggctct{ag}gt.................... : 78271 44 : >>>> {r}ThrArgAspPheThr >>>> Target Intron 3 >>>> >> : 49 {!}|||||| ||| 3036 bp ++{r}ThrArgValPheGln-+ ++++ 78272 : .....ag{c}accagggtctttcagat.........................aggt.. : 90714 50 : >> Target Intron 4 >>>> GlnLeuAsnGluLeu{G} >>>> Target I : 54 8405 bp :!!.!.|||:!!{ } 2649 ++LeuValGlnGluVal{G}++ 90715 : .......................agctaGTCCAGGAGGTA{G}gt............. : 99135 55 : ntron 5 >>>> {ln}CysArgPheProArgArgLeuValValLeuGlyPheProC : 68 8 bp { } ||| ! ||| !|||:!! ! !||||||! ! ++{ly}ThrArgValProAlaArgIleSerSerLeuGlySerGluV 99136 : ............ag{GC}ACGCGTGTGCCAGCTAGGATTTCATCCTTGGGTTCAGAGG : 125672 69 : ysAsnGlnPheGlyHisGlnGluAsnCysGlnAsnGlu >>>> Target Intron : 81 !!.! !..!|||!:! ! ...||| 18996 bp alThrAlaAlaSerHisArgLeuTrpGlnValGlyGlu++ 125673 : TCACTGCTGCTTCACACCGACTGTggcaggtgggggaggt.................. : 125713 82 : 6 >>>> GluIleLeuAsnSerLeu{Ly} >>>> Target Intron 7 >>>> : 87 |||:::|||:!! ! !{!:} 1597 bp +-GluValLeuHisValGly{Ar}++ 125714 : .......aagaagtatTGCATGTTGGT{AG}gt......................... : 144729 88 : {s}TyrValArgProGlyGly{G} >>>> Target Intron 8 >>>> {ly : 94 {!}:!!..!||||||!..|||{|} 9476 bp {|| ++{g}HisThrArgProAlaGly{G}++ ++{ly 144730 : ag{A}CACACCCGTCCTGCtggg{g}gt.........................ag{GG : 155820 95 : }TyrGlnProThrPheThrLeuValGlnLysCysGluValAsnGly{Gl} >>>> T : 110 }:!! ! ! ! !.! !:!!!!.!..|||..!! !||||||{..} }HisPheLeuAspGluAsnThrIleHisSerCysSerGluAsnGly{Me}++ 155821 : }CATTTTCTGGATGAAAATACAATTCATAGCTGCTCAGAAAACGGA{AT}gt...... : 155871 111 : arget Intron 9 >>>> {n}AsnGluHisProValPheAlaTyr{Le} >>>> : 119 80397 bp {!}:!! ||||||! !||||||!:!{||} ++{t}AspThrHisProGlyPheAlaPhe{Le}++ 155872 : ...................ag{G}GATACCCACCCAGGATTTGCCTTC{TT}gt.... : 236295 120 : Target Intron 10 >>>> {u}LysAspLysLeuProTyrProTyrAspAspP : 130 99372 bp {|}!:!! !:!!||| ! ! |||!:! !..!| -+{u}ArgAlaGlnLeuValGlnProPheCysSerP 236296 : ......................gg{A}AGAGCTCAGCTAGTGCAACCCTTCTGCAGCC : 335696 131 : roPheSerLeuMetThrAspProLysLeuIleIleTrpSerProValArgArg{Se} : 148 ||||||||! ! ! !||| ! ! ! |||||| !:!! !!.!{||} roPheSerProSerHisThrProAlaGlnGluArgTrpSerAspIleAlaAsn{Se}+ 335697 : CCTTTTCCCCTTCACACACTCCTGCCCAGGAGAGGTGGAGTGACATAGCAAAT{AG}g : 335752 149 : >>>> Target Intron 11 >>>> {r}AspValAlaTrpAsnPheGluLysPh : 157 63806 bp {|}||| !|||||||||||||||||||| + --{r}AspProAlaTrpAsnPheGluLysPh 335753 : t..........................ct{T}GACCCAGCATGGAACTTCGAGAAATT : 399583 158 : e{Le} >>>> Target Intron 12 >>>> {u}IleGlyProGluGlyGluPr : 165 |{ } 10931 bp {!}:!!!.!||||||||| !|| e{Ly}+- ++{s}LeuAlaProGluGlyLeuPr 399584 : C{AA}ga..........................ag{G}CTTGCACCTGAGGGTTTGCC : 410538 166 : oPheArg{A} >>>> Target Intron 13 >>>> {rg}TyrSerArgThrPh : 173 |! !! !{|} 148688 bp {||} ... || oSerThr{A}-+ ++{rg}IleGluProArgPh 410539 : GTCCACA{C}ct..........................ag{gg}atagaacccaggtt : 559250 174 : eProThrIleAsnIleGluProAsp >>>> Target Intron 14 >>>> Ile : 182 | |||:!:... ||||||... 191164 bp :!! eSerThrLeuGlnAlaGluProGln+- ++Val 559251 : ttctACACTGcaggctgagccacaggg..........................agGTT : 750441 183 : LysArgLeuLeuLysVal : 188 ..!!:!:!!||||||||| SerLysIleLeuLysVal 750442 : TCAAAGATCCTGAAGGTA : 750461 vulgar: SPP00000005_1.0 23 188 . NIVO01055543.1 48153 750461 + 114 M 14 42 S 0 2 5 0 2 I 0 30052 3 0 2 S 1 1 M 4 12 S 0 2 5 0 2 I 0 9387 3 0 2 S 1 1 M 5 15 5 0 2 I 0 3032 3 0 2 5 0 2 I 0 8401 3 0 2 M 5 15 S 0 1 5 0 2 I 0 26494 3 0 2 S 1 2 M 26 78 5 0 2 I 0 18992 3 0 2 M 6 18 S 0 2 5 0 2 I 0 1593 3 0 2 S 1 1 M 6 18 S 0 1 5 0 2 I 0 9472 3 0 2 S 1 2 M 15 45 S 0 2 5 0 2 I 0 80393 3 0 2 S 1 1 M 8 24 S 0 2 5 0 2 I 0 99368 3 0 2 S 1 1 M 28 84 S 0 2 5 0 2 I 0 63802 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 10927 3 0 2 S 1 1 M 9 27 S 0 1 5 0 2 I 0 148684 3 0 2 S 1 2 M 13 39 5 0 2 I 0 191160 3 0 2 M 7 21 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 48154 750461 114 + . gene_id 5 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 48154 48197 . + . NIVO01055543.1 exonerate:protein2genome:local exon 48154 48197 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 48198 48199 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 48198 78253 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 78252 78253 . + . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 78254 78268 . + . NIVO01055543.1 exonerate:protein2genome:local exon 78254 78268 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 78269 78270 . + . intron_id 2 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 78269 87659 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 87658 87659 . + . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 87660 87675 . + . NIVO01055543.1 exonerate:protein2genome:local exon 87660 87675 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 87676 87677 . + . intron_id 3 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local intron 87676 90711 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 90710 90711 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 90712 90713 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 90712 99116 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 99115 99116 . + . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 99117 99132 . + . NIVO01055543.1 exonerate:protein2genome:local exon 99117 99132 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 99133 99134 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 99133 125630 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 125629 125630 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 125631 125710 . + . NIVO01055543.1 exonerate:protein2genome:local exon 125631 125710 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 125711 125712 . + . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 125711 144706 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 144705 144706 . + . intron_id 5 ; splice_site "aa" NIVO01055543.1 exonerate:protein2genome:local cds 144707 144726 . + . NIVO01055543.1 exonerate:protein2genome:local exon 144707 144726 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 144727 144728 . + . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 144727 146323 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 146322 146323 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 146324 146343 . + . NIVO01055543.1 exonerate:protein2genome:local exon 146324 146343 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 146344 146345 . + . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 146344 155819 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 155818 155819 . + . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 155820 155868 . + . NIVO01055543.1 exonerate:protein2genome:local exon 155820 155868 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 155869 155870 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 155869 236265 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 236264 236265 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 236266 236292 . + . NIVO01055543.1 exonerate:protein2genome:local exon 236266 236292 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 236293 236294 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 236293 335664 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 335663 335664 . + . intron_id 9 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local cds 335665 335751 . + . NIVO01055543.1 exonerate:protein2genome:local exon 335665 335751 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 335752 335753 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 335752 399557 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 399556 399557 . + . intron_id 10 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local cds 399558 399587 . + . NIVO01055543.1 exonerate:protein2genome:local exon 399558 399587 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 399588 399589 . + . intron_id 12 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 399588 410518 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 410517 410518 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 410519 410547 . + . NIVO01055543.1 exonerate:protein2genome:local exon 410519 410547 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 410548 410549 . + . intron_id 13 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 410548 559235 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 559234 559235 . + . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 559236 559276 . + . NIVO01055543.1 exonerate:protein2genome:local exon 559236 559276 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 559277 559278 . + . intron_id 14 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 559277 750440 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 750439 750440 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 750441 750461 . + . NIVO01055543.1 exonerate:protein2genome:local exon 750441 750461 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 48154 750461 114 + . alignment_id 5 ; Query SPP00000005_1.0 ; Align 48154 24 42 ; Align 78255 39 12 ; Align 87661 44 15 ; Align 99117 49 15 ; Align 125633 55 78 ; Align 144707 81 18 ; Align 146325 88 18 ; Align 155822 95 45 ; Align 236267 111 24 ; Align 335666 120 84 ; Align 399559 149 27 ; Align 410520 159 27 ; Align 559238 169 39 ; Align 750441 182 21 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 114 Query range: 2 -> 180 Target range: 84858 -> 956935 3 : PheIleAla{Ly} >>>> Target Intron 1 >>>> {s}SerPheTyrAspL : 11 |||::: {!:} 30100 bp {!}||| ||| ! PheLeuMet{Ar}++ ++{g}SerAlaTyrCysA 84859 : tttctcatg{ag}gt.........................ag{A}AGTGCGTACTGTG : 114983 12 : euSerAlaIleSerLeuAspGlyGluLysValAspPheAsnThrPheArgGlyArgAl : 30 !:!!:!!:!!:!!! ! !.!.! :!! ! :!! !|||..!|||! !|| laAlaSerValAlaSerLeuThrAsnIleIleThrProAspLeuPheGluGlyThrAl 114984 : CTGCCTCGGTAGCTTCGTTGACCAACATCATCACCCCAGACCTGTTTGAGGGCACTGC : 115040 31 : aValLeuIleGlu{As} >>>> Target Intron 2 >>>> {n}ValAlaSer : 38 |! !! !|||! !{!:} 28421 bp {!} !||| !! aGluTrpIleAla{Se}++ ++{r}ProAlaArg 115041 : TGAATGGATCGCA{AG}gt.........................ag{C}CCAGCACGC : 143485 39 : LeuUnkGlyThrThrThrArgAspPheThrGlnLeu{As} >>>> Target Intr : 51 |||...|||:!! !||| !..!||||||...! !{.!} 1182 bp LeuThrGlySerTrpThrSerSerPheThrSerSer{Gl}++ 143486 : CTAACTGGTTCCTGGACATCCTCTTTCACTTCCTCG{CA}gt................ : 143528 52 : on 3 >>>> {n}GluLeuGlnCys{Ar} >>>> Target Intron 4 >>>> : 56 {.}...::! !|||{ !} 22466 bp ++{n}SerIleAlaCys{Tr}++ + 143529 : .........ag{a}agtatTGCATGT{TG}gt.........................a : 167187 57 : {g}PheProArg{Ar} >>>> Target Intron 5 >>>> {g}LeuValVal : 63 {!}.!.|||..!{||} 33797 bp {|}! !:!! ! +{p}LeuProGlu{Ar}++ ++{g}SerLeuArg 167188 : g{G}CTGCCAGAA{AG}gt.........................ag{A}TCACTCCGG : 201005 64 : Leu >>>> Target Intron 6 >>>> GlyPheProCysAsnGlnPheGlyHi : 73 ||| 35448 bp ||||||||| ...... ||| Leu++ ++GlyPheProAspGlySerValGlyLy 201006 : CTGgt.........................agggctttcctgatggctccgttggtaa : 236483 74 : sGlnGluAsnCysGln >>>> Target Intron 7 >>>> AsnGluGluIleL : 83 ::: ...|||... 83818 bp |||:!! !|||: sGluTyrThrCysAsn++ ++AsnLysLeuIleI 236484 : agaatatacctgtaatgt.........................agAATAAACTGATAA : 320331 84 : eu{As} >>>> Target Intron 8 >>>> {n}SerLeuLysTyrValArgPr : 91 !!{.!} 24125 bp {.}...:::||| |||...|| le{Gl}++ +-{u}GluIleLysProValAsnPr 320332 : TC{GA}gt.........................aa{g}gagattaaaccagtcaatcc : 344480 92 : oGlyGlyGlyTyrGln >>>> Target Intron 9 >>>> ProThrPheThrL : 101 | |||...:::||| 23275 bp ||| !|||!:!| oLysGlyAsnPheGln++ +-ProAspPheSerL 344481 : taaaggaaattttcAGgt.........................acCCAGATTTCAGCC : 367785 102 : eu >>>> Target Intron 10 >>>> ValGlnLysCysGluValAsnGlyGl : 110 || 91412 bp !...!:!||| ...|||:: eu++ ++SerSerArgCysTrpLysGluGlyGl 367786 : TGgt..........................agAGTTCCAGATgttggaaagagggaga : 459224 111 : nAsnGluHisProVal{P} >>>> Target Intron 11 >>>> {he}AlaTy : 118 :...|||||||||:!!{ } 59642 bp { !}:!!|| uArgGluHisProLeu{A}++ ++{sn}SerTy 459225 : gagagaacacCCACTT{A}gt..........................ag{AC}TCTTA : 518890 119 : r{Le} >>>> Target Intron 12 >>>> {u}Lys{A} >>>> Target : 121 |{||} 27923 bp {|}|||{!} 117 r{Le}++ ++{u}Lys{V}++ 518891 : T{CT}gt..........................ag{G}AAA{G}gt............ : 546825 122 : Intron 13 >>>> {sp}LysLeuProTyrProTyrAspAspProPheSerLeuMe : 134 601 bp { !}..! !||||||||| ! !! !|||...|||||| ++{al}SerAsnProTyrProGlnHisProProLeuSerLeuAl 546826 : ..............ag{TC}TCAAATCCCTATCCCCAACATCCTCCTCtatctttagc : 664462 135 : tThrAspProLysLeu{I} >>>> Target Intron 14 >>>> {le}IleTr : 142 ||| !{ } 7997 bp { !} || aGluAspGlyIleGln{A}++ ++{la}TyrTr 664463 : tgaagatggtattcaG{G}gt..........................ag{ca}tattg : 672483 143 : pSerProValArgArgSerAspValAlaTrpAsnPheGluLysPheLeu{I} >>>> : 159 |:::|||... ...... |||!:::!!!:!:!!|||!:! !{|} pAlaProThrAspLeuGlySerCysAlaTyrHisTyrGlnLysTyrAsn{I}++ 672484 : ggcacctacagacctggggagttgtGCTTACCACTACCAAAAATATAAT{A}gt.... : 672537 160 : Target Intron 15 >>>> {le}GlyProGluGlyGlu{Pr} >>>> Targ : 165 185283 bp {||} ! !|||||||||{ } ++{le}LeuArgGluGlyGlu{Tr}++ 672538 : ......................ag{TT}CTGAGAGAGGGAGAA{TG}gt......... : 857839 166 : et Intron 16 >>>> {o}PheArgArgTyrSerArgThrPheProThrIleAsn : 177 99053 bp {!}|||!:!!:!:!!|||! ||||||... ++{p}PheLysLysHisSerLeuPhePheProAlaAlaAla 857840 : .................ag{G}TTCAAAAAGCACTCCCTctttttccctgctgctgct : 956924 178 : IleGluPro : 180 ::: ||| ValTyrPro 956925 : gtctaCCCT : 956935 vulgar: SPP00000005_1.0 2 180 . NIVO01055543.1 84858 956935 + 114 M 3 9 S 0 2 5 0 2 I 0 30096 3 0 2 S 1 1 M 28 84 S 0 2 5 0 2 I 0 28417 3 0 2 S 1 1 M 15 45 S 0 2 5 0 2 I 0 1178 3 0 2 S 1 1 M 4 12 S 0 2 5 0 2 I 0 22462 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 33793 3 0 2 S 1 1 M 4 12 5 0 2 I 0 35444 3 0 2 M 14 42 5 0 2 I 0 83814 3 0 2 M 5 15 S 0 2 5 0 2 I 0 24121 3 0 2 S 1 1 M 12 36 5 0 2 I 0 23271 3 0 2 M 5 15 5 0 2 I 0 91408 3 0 2 M 14 42 S 0 1 5 0 2 I 0 59638 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 27919 3 0 2 S 1 1 M 1 3 S 0 1 5 0 2 I 0 117597 3 0 2 S 1 2 M 18 54 S 0 1 5 0 2 I 0 7993 3 0 2 S 1 2 M 18 54 S 0 1 5 0 2 I 0 185279 3 0 2 S 1 2 M 5 15 S 0 2 5 0 2 I 0 99049 3 0 2 S 1 1 M 15 45 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 84859 956935 114 + . gene_id 6 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 84859 84869 . + . NIVO01055543.1 exonerate:protein2genome:local exon 84859 84869 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 84870 84871 . + . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 84870 114969 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 114968 114969 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 114970 115056 . + . NIVO01055543.1 exonerate:protein2genome:local exon 114970 115056 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 115057 115058 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 115057 143477 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 143476 143477 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 143478 143525 . + . NIVO01055543.1 exonerate:protein2genome:local exon 143478 143525 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 143526 143527 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 143526 144707 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 144706 144707 . + . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 144708 144722 . + . NIVO01055543.1 exonerate:protein2genome:local exon 144708 144722 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 144723 144724 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 144723 167188 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 167187 167188 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 167189 167200 . + . NIVO01055543.1 exonerate:protein2genome:local exon 167189 167200 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 167201 167202 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 167201 200997 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 200996 200997 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 200998 201010 . + . NIVO01055543.1 exonerate:protein2genome:local exon 200998 201010 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 201011 201012 . + . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 201011 236458 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 236457 236458 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 236459 236500 . + . NIVO01055543.1 exonerate:protein2genome:local exon 236459 236500 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 236501 236502 . + . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 236501 320318 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 320317 320318 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 320319 320335 . + . NIVO01055543.1 exonerate:protein2genome:local exon 320319 320335 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 320336 320337 . + . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 320336 344460 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 344459 344460 . + . intron_id 7 ; splice_site "aa" NIVO01055543.1 exonerate:protein2genome:local cds 344461 344497 . + . NIVO01055543.1 exonerate:protein2genome:local exon 344461 344497 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 344498 344499 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 344498 367772 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 367771 367772 . + . intron_id 8 ; splice_site "AC" NIVO01055543.1 exonerate:protein2genome:local cds 367773 367787 . + . NIVO01055543.1 exonerate:protein2genome:local exon 367773 367787 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 367788 367789 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 367788 459199 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 459198 459199 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 459200 459242 . + . NIVO01055543.1 exonerate:protein2genome:local exon 459200 459242 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 459243 459244 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 459243 518884 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 518883 518884 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 518885 518894 . + . NIVO01055543.1 exonerate:protein2genome:local exon 518885 518894 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 518895 518896 . + . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 518895 546817 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 546816 546817 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 546818 546822 . + . NIVO01055543.1 exonerate:protein2genome:local exon 546818 546822 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 546823 546824 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 546823 664423 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 664422 664423 . + . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 664424 664480 . + . NIVO01055543.1 exonerate:protein2genome:local exon 664424 664480 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 664481 664482 . + . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 664481 672477 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 672476 672477 . + . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 672478 672534 . + . NIVO01055543.1 exonerate:protein2genome:local exon 672478 672534 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 672535 672536 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 672535 857817 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 857816 857817 . + . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 857818 857836 . + . NIVO01055543.1 exonerate:protein2genome:local exon 857818 857836 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 857837 857838 . + . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 857837 956889 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 956888 956889 . + . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 956890 956935 . + . NIVO01055543.1 exonerate:protein2genome:local exon 956890 956935 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 84859 956935 114 + . alignment_id 6 ; Query SPP00000005_1.0 ; Align 84859 3 9 ; Align 114971 7 84 ; Align 143479 36 45 ; Align 144709 52 12 ; Align 167190 57 9 ; Align 200999 61 12 ; Align 236459 65 42 ; Align 320319 79 15 ; Align 344462 85 36 ; Align 367773 97 15 ; Align 459200 102 42 ; Align 518887 117 6 ; Align 546819 120 3 ; Align 664426 122 54 ; Align 672480 141 54 ; Align 857820 160 15 ; Align 956891 166 45 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 111 Query range: 17 -> 175 Target range: 7522 -> 1021358 18 : GlyGluLysValAspPheAsnThrPheArgGlyArgAlaValLeuIleGluAsnVa : 36 ||| ... |||::: ... ||| ||| ::: GlyMetAlaThrHisPheSerIleLeuAlaTrpArgIleProCysIleValHisGl 7523 : ggaatggccacccacttcagtattctagcctggagaattccatgtatagtccatgg : 7577 37 : lAlaSerLeuUnkGlyThrThrThrArgAspPheThrGlnLeuAsnGlu{L} >> : 53 ...::: ... ||| ... |||||||||...|||::::::{:} yValAlaLysSerArgThrCysValSerAspPheThrSerLeuHisLys{V}++ 7578 : ggtcgcaaagagtcggacatgcgtgagcgacttcacttcacttcacaaa{g}gt.. : 7631 54 : >> Target Intron 1 >>>> {eu}GlnCys{A} >>>> Target Intr : 56 25250 bp {!!}||||||{|} 26213 b ++{al}GlnCys{A}++ 7632 : .......................ag{TG}CAGTGC{A}gt................ : 32890 57 : on 2 >>>> {rg}PheProArg >>>> Target Intron 3 >>>> > : 60 p {||}||||||||| 31600 bp ++{rg}PheProArg+- ++++ 32891 : .........ag{GA}TTCCCACGGgc.........................aggt. : 90714 61 : >>> Target Intron 4 >>>> ArgLeuValValLeuGlyPhePro{Cy} : 68 1108 bp ||| !||||||:!!..!||||||{! } ++ArgArgValValIleSerPhePro{Le}++ 90715 : ........................agAGGAGAGTGGTCATCTCATTTCCA{TT}gt : 91846 69 : >>>> Target Intron 5 >>>> {s}AsnGlnPheGlyHisGlnGluAsnCy : 77 88696 bp { }::! !::..!|||! !:!! ++{u}SerThrTrpAsnHisProGlnAlaTh 91847 : .........................ag{G}TCTACTTGGAATCACCCACAGGCAAC : 180567 78 : sGlnAsnGluGluIleLeuAsnSerLeu{Ly} >>>> Target Intron 6 > : 87 !|||||| !..!:!!:!!|||..! !{||} 144466 bp rGlnAsnLeuArgLeuMetAsnGluLys{Ly}++ 180568 : TCAAAACCTGAGGCTTATGAATGAGAAA{AA}gt...................... : 180601 88 : >>> {s}TyrValArgProGlyGly{G} >>>> Target Intron 7 >>>> : 94 {|}|||:!!||| !! ! !{|} 70560 bp ++{s}TyrLeuArgGlyAspLys{G}++ 180602 : ...ag{G}TACCTCAGAGGTGACAAG{G}gt......................... : 325087 95 : {ly}TyrGlnProThrPheThrLeuValGlnLysCysGlu{V} >>>> Targ : 107 {||} :::||||||||| {!} ++{ly}IleGluProThrPheLeuThrSerProAlaLeuAla{A}++ 325088 : ag{gg}atcgaacccacatttcttacatctcctgcattggca{g}gt......... : 395686 108 : et Intron 8 >>>> {al}AsnGlyGlnAsnGluHisProValPheAla{Ty} : 118 841 bp {.!}||||||!!. :!!:!! !:!!||| !{! } ++{la}AsnGlyHisLeuGlnAsnLysLeuPheAsn{Cy} 395687 : ................ag{CA}AACGGGCATTTACAGAACAAATTGTTTAAC{TG} : 396557 119 : >>>> Target Intron 9 >>>> {r}LeuLysAsp{Ly} >>>> Targ : 122 53091 bp {!}|||!..|||{ } ++ ++{s}LeuSerAsp{Tr}++ 396558 : gt.........................ag{T}CTCAGTGAC{TG}gt......... : 449664 123 : et Intron 10 >>>> {s}LeuProTyrProTyrAspAspPro{P} >>>> : 131 176097 bp {!}||||||:::|||:::|||...|||{ } ++{p}LeuProHisProTrpAspSerPro{A}+- 449665 : .................ag{g}ctcccccatccctgggattctcca{g}gc..... : 625787 132 : Target Intron 11 >>>> {he}{Se} >>>> Target Intron 12 > : 132 9657 bp { !}{||} 110627 bp ++{la}{Se}++ 625788 : .....................ag{CC}{AG}gt....................... : 635448 133 : >>> {r}LeuMetThr{As} >>>> Target Intron 13 >>>> {p}Pr : 137 {|}|||:!:|||{ !} 27423 bp { }|| ++{r}LeuLeuThr{Ly}++ ++{s}Pr 635449 : ...ag{C}CTCCTAACA{AA}gt..........................ag{G}CC : 773509 138 : oLysLeuIleIleTrp{Se} >>>> Target Intron 14 >>>> {r}Pro : 144 ||||:!!|||! |||{||} 6276 bp {|}||| oLysValIleArgTrp{Se}++ ++{r}Pro 773510 : TAAAGTCATTAGGTGG{AG}gt..........................ag{C}CCT : 779806 145 : ValArgArgSer{A} >>>> Target Intron 15 >>>> {sp}ValAlaT : 152 ||| !! !.!!{!} 17548 bp { }!.!|||| ValTyrProGly{G}++ ++{ly}AlaAlaT 779807 : GTATATCCTGGA{G}gt..........................ag{GG}GCAgcat : 797378 153 : rpAsnPheGlu{Ly} >>>> Target Intron 16 >>>> {s}PheLeuIl : 159 ||... :::{||} 116881 bp {|}||||||! rpGluLysLys{Ly}++ ++{s}PheLeuTh 797379 : gggagaaaaaa{aa}gt..........................ag{g}ttcttGAC : 914280 160 : e{G} >>>> Target Intron 17 >>>> {ly}ProGluGly >>>> Ta : 164 !{|} 60020 bp {||}||| ! r{G}++ ++{ly}ProLeuMet++ 914281 : A{G}gt..........................ag{GA}CCACTTATGgt....... : 974317 165 : rget Intron 18 >>>> GluProPheArgArgTyrSerArgThrPheProTh : 175 47008 bp ||||||! ! !!.! ..!!.!|||||||||:! ++GluProSerLeuHisThrGlnAsnThrPheProSe 974318 : ...................agGAACCATCTTTGCACACACAAAATACATTTCCATC : 1021356 176 : r : 175 ! r 1021357 : C : 1021358 vulgar: SPP00000005_1.0 17 175 . NIVO01055543.1 7522 1021358 + 111 M 35 105 S 0 1 5 0 2 I 0 25246 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 26209 3 0 2 S 1 2 M 3 9 5 0 2 I 0 31596 3 0 2 5 0 2 I 0 1104 3 0 2 M 8 24 S 0 2 5 0 2 I 0 88692 3 0 2 S 1 1 M 18 54 S 0 2 5 0 2 I 0 144462 3 0 2 S 1 1 M 6 18 S 0 1 5 0 2 I 0 70556 3 0 2 S 1 2 M 12 36 S 0 1 5 0 2 I 0 837 3 0 2 S 1 2 M 10 30 S 0 2 5 0 2 I 0 53087 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 176093 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 9653 3 0 2 S 1 4 5 0 2 I 0 110623 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 27419 3 0 2 S 1 1 M 6 18 S 0 2 5 0 2 I 0 6272 3 0 2 S 1 1 M 5 15 S 0 1 5 0 2 I 0 17544 3 0 2 S 1 2 M 6 18 S 0 2 5 0 2 I 0 116877 3 0 2 S 1 1 M 3 9 S 0 1 5 0 2 I 0 60016 3 0 2 S 1 2 M 3 9 5 0 2 I 0 47004 3 0 2 M 12 36 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 7523 1021358 111 + . gene_id 7 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 7523 7628 . + . NIVO01055543.1 exonerate:protein2genome:local exon 7523 7628 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 7629 7630 . + . intron_id 1 ; splice_site "gT" NIVO01055543.1 exonerate:protein2genome:local intron 7629 32878 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 32877 32878 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 32879 32887 . + . NIVO01055543.1 exonerate:protein2genome:local exon 32879 32887 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 32888 32889 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 32888 59100 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 59099 59100 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 59101 59111 . + . NIVO01055543.1 exonerate:protein2genome:local exon 59101 59111 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 59112 59113 . + . intron_id 3 ; splice_site "GC" NIVO01055543.1 exonerate:protein2genome:local intron 59112 90711 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 90710 90711 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 90712 90713 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 90712 91819 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 91818 91819 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 91820 91845 . + . NIVO01055543.1 exonerate:protein2genome:local exon 91820 91845 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 91846 91847 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 91846 180541 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 180540 180541 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 180542 180598 . + . NIVO01055543.1 exonerate:protein2genome:local exon 180542 180598 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 180599 180600 . + . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 180599 325064 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 325063 325064 . + . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 325065 325084 . + . NIVO01055543.1 exonerate:protein2genome:local exon 325065 325084 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 325085 325086 . + . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 325085 395644 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 395643 395644 . + . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 395645 395683 . + . NIVO01055543.1 exonerate:protein2genome:local exon 395645 395683 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 395684 395685 . + . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 395684 396524 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 396523 396524 . + . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 396525 396558 . + . NIVO01055543.1 exonerate:protein2genome:local exon 396525 396558 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 396559 396560 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 396559 449649 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 449648 449649 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 449650 449661 . + . NIVO01055543.1 exonerate:protein2genome:local exon 449650 449661 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 449662 449663 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 449662 625758 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 625757 625758 . + . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 625759 625784 . + . NIVO01055543.1 exonerate:protein2genome:local exon 625759 625784 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 625785 625786 . + . intron_id 11 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 625785 635441 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 635440 635441 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 635442 635445 . + . NIVO01055543.1 exonerate:protein2genome:local exon 635442 635445 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 635446 635447 . + . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 635446 746072 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 746071 746072 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 746073 746084 . + . NIVO01055543.1 exonerate:protein2genome:local exon 746073 746084 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 746085 746086 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 746085 773507 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 773506 773507 . + . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 773508 773528 . + . NIVO01055543.1 exonerate:protein2genome:local exon 773508 773528 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 773529 773530 . + . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 773529 779804 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 779803 779804 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 779805 779821 . + . NIVO01055543.1 exonerate:protein2genome:local exon 779805 779821 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 779822 779823 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 779822 797369 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 797368 797369 . + . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 797370 797391 . + . NIVO01055543.1 exonerate:protein2genome:local exon 797370 797391 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 797392 797393 . + . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 797392 914272 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 914271 914272 . + . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 914273 914283 . + . NIVO01055543.1 exonerate:protein2genome:local exon 914273 914283 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 914284 914285 . + . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 914284 974303 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 974302 974303 . + . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 974304 974314 . + . NIVO01055543.1 exonerate:protein2genome:local exon 974304 974314 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 974315 974316 . + . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 974315 1021322 . + . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 1021321 1021322 . + . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1021323 1021358 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1021323 1021358 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 7523 1021358 111 + . alignment_id 7 ; Query SPP00000005_1.0 ; Align 7523 18 105 ; Align 32881 54 6 ; Align 59103 57 9 ; Align 91820 60 24 ; Align 180543 69 54 ; Align 325066 88 18 ; Align 395647 95 36 ; Align 396527 108 30 ; Align 449651 119 9 ; Align 625760 123 24 ; Align 746074 133 9 ; Align 773509 137 18 ; Align 779806 144 15 ; Align 797372 150 18 ; Align 914274 157 9 ; Align 974306 161 9 ; Align 1021323 164 36 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 113 Query range: 3 -> 180 Target range: 124413 -> 1151042 4 : IleAlaLysSerPheTyrAspLeuSerAlaIleSer{L} >>>> Target Int : 16 :!!::! ! |||||| ! !!:||||||!.!:!!!.!{|} 105856 LeuSerAspSerPheGlnGluLeuSerValValLys{L}++ 124414 : CTCAGTGACTCTTTTCAGGAACTCAGTGTAGTAAAA{C}gt............... : 124453 17 : ron 1 >>>> {eu}AspGlyGluLys >>>> Target Intron 2 >>>> : 21 bp {||} !||||||||| 40315 bp ++{eu}PheGlyGluLys++ + 124454 : ..........ag{TT}TTTGGTGAGAAAgt.........................a : 270634 22 : ValAspPheAsnThrPheArgGlyArgAlaValLeuIleGlu{A} >>>> Tar : 35 ||| ||| |||...... |||:::...{.} +GlyIlePheProThrGlnArgSerAsnProGlyLeuLeuHis{G}++ 270635 : ggggatcttcccaacacagagatcgaacccaggtctcctgcat{g}gt........ : 270681 36 : get Intron 3 >>>> {sn}ValAlaSerLeuUnkGlyThrThrThrArgAsp : 46 44970 bp {..}::: ::::::... ||| ||| ++{ly}IleGluAlaMetSerProThrLeuLysAlaAsp 270682 : .................ag{gg}atcgaagccatgtctcctacactgaaggcagat : 315681 47 : PheThrGlnLeuAsnGluLeu >>>> Target Intron 4 >>>> GlnCys : 55 |||::: ||| 34504 bp ||| SerLeuProLeuSerProLeu+- ++ThrCys 315682 : tccttaccactgagccctctggg.........................agACCTGT : 350212 56 : ArgPheProArgArgLeuValVal{Le} >>>> Target Intron 5 >>>> : 64 ! !|||||||||! !:!!{! } 53578 bp SerArgLysArgArgLeuGlyMet{Tr}++ + 350213 : TCCAGGAAGAGAAGGTTAGGAATG{TG}gt.........................a : 403817 65 : {u}GlyPhePro{Cy} >>>> Target Intron 6 >>>> {s}AsnGln{ : 71 {!}|||||||||{ !} 5056 bp { }||||||{ -{p}GlyPhePro{Ar}+- ++{g}AsnGln{ 403818 : t{g}ggatttccc{ag}gc.........................ag{A}AATCAA{ : 408894 72 : Ph} >>>> Target Intron 7 >>>> {e}GlyHisGlnGluAsnCysGln : 78 } 8101 bp { }|||!!...! !||| !:!! Ar}++ ++{g}GlyGlnSerIleAsnValLys 408895 : CG}gt.........................ag{A}GGCCAGTCGATAAATGTTAAA : 417016 79 : AsnGluGluIleLeuAsnSerLeuLys{T} >>>> Target Intron 8 >>> : 88 ! !!:||||||! !|||!!! !|||{ } 141988 bp ***AspGluIleCysAsnThrThrLys{G}++ 417017 : TAGGATGAAATCTGTAATACAACCAAA{G}gt........................ : 417049 89 : > {yr}ValArgProGlyGlyGlyTyrGlnProThrPheThrLeuValGln >> : 104 { }||| |||||| ||| ::: ||| ::: ||| ++{ly}ValLeuProGlyProGlyIleLysLeuThrSerSerAlaTrpGln+- 417050 : .ag{gg}gttcttcctggcccagggatcaaactcacatctagtgcttggcaggc.. : 559084 105 : >> Target Intron 9 >>>> LysCysGlu >>>> Target Intron 1 : 107 42278 bp ||||||.!. 87869 bp ++LysCysAsn++ 559085 : .......................agAAATGCAATgt.................... : 601371 108 : 0 >>>> ValAsnGly{Gl} >>>> Target Intron 11 >>>> {n}As : 111 :!!||||||{:!} 89262 bp {!}.. ++IleAsnGly{Ly}++ ++{s}Gl 601372 : ......agATAAATGGC{AA}gt..........................ag{g}ca : 778512 112 : nGluHisPro{V} >>>> Target Intron 12 >>>> {al}PheAlaTyr : 118 .|||||| {:} 46355 bp {!!}||| !||| nGluHisTrp{I}++ +-{le}PheGlnTyr 778513 : agaacactgg{a}gt..........................at{TA}TTCCAGTAC : 824888 119 : LeuLys{As} >>>> Target Intron 13 >>>> {p}LysLeuProTyrP : 126 |||! { } 52575 bp { } |||||| | LeuThr{Tr}++ ++{p}AspLeuProAsnP 824889 : CTCACC{TG}gt..........................ag{g}gatctccctaacc : 877487 127 : roTyrAspAspProPheSerLeuMetThrAsp >>>> Target Intron 14 : 137 ||::: :::||| ||| :::... 143881 bp roTrpIleGluProGluSerProAlaSerGln++ 877488 : catggattgaacctgagtctcccgcatcacaggt...................... : 877522 138 : >>>> ProLysLeuIleIle{Tr} >>>> Target Intron 15 >>>> { : 142 ||| !! !:!!:!!{||} 14796 bp { ++ProLeuSerLeuLeu{Tr}++ ++{ 877523 : ....agCCTCTGTCCCTCCTT{TG}gt..........................ag{ : 1036214 143 : p}SerProValArgArgSerAspValAla{Tr} >>>> Target Intron 16 : 152 |}!!!! !:!!|||!:!!!!||| !.!!{||} 49117 bp p}***LeuIleArgLysThrAspTyrThr{Tr}++ 1036215 : G}TGACTGATAAGAAAAACTGACTATACA{TG}gt..................... : 1036246 153 : >>>> {p}AsnPheGlu{Ly} >>>> Target Intron 17 >>>> {s} : 156 {|}...|||...{!.} 65597 bp {.} +-{p}GlyPheSer{Se}++ ++{r} 1036247 : .....at{g}ggattctcc{ag}gt..........................ag{c} : 1150970 157 : PheLeuIleGlyProGluGlyGluProPheArgArgTyrSerArgThrPheProTh : 175 :::||| ||| ||||||||| :::::: ||| TyrLeu***GlyLeuLeuArgGluProPheCysLeuPheAlaPheLeuPheLeuAr 1150971 : tatttgtaaggcctcctcagagaaccattttgcctttttgcatttctttttcttag : 1151025 176 : rIleAsnIleGluPro : 180 ...:::...||| gAsnGlyLeuAsnPro 1151026 : gaatggtcttaatccc : 1151042 vulgar: SPP00000005_1.0 3 180 . NIVO01055543.1 124413 1151042 + 113 M 12 36 S 0 1 5 0 2 I 0 105852 3 0 2 S 1 2 M 4 12 5 0 2 I 0 40311 3 0 2 M 14 42 S 0 1 5 0 2 I 0 44966 3 0 2 S 1 2 M 18 54 5 0 2 I 0 34500 3 0 2 M 10 30 S 0 2 5 0 2 I 0 53574 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 5052 3 0 2 S 1 1 M 2 6 S 0 2 5 0 2 I 0 8097 3 0 2 S 1 1 M 16 48 S 0 1 5 0 2 I 0 141984 3 0 2 S 1 2 M 15 45 5 0 2 I 0 42274 3 0 2 M 3 9 5 0 2 I 0 87865 3 0 2 M 3 9 S 0 2 5 0 2 I 0 89258 3 0 2 S 1 1 M 4 12 S 0 1 5 0 2 I 0 46351 3 0 2 S 1 2 M 5 15 S 0 2 5 0 2 I 0 52571 3 0 2 S 1 1 M 15 45 5 0 2 I 0 143877 3 0 2 M 5 15 S 0 2 5 0 2 I 0 14792 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 49113 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 65593 3 0 2 S 1 1 M 24 72 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 124414 1151042 113 + . gene_id 8 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 124414 124450 . + . NIVO01055543.1 exonerate:protein2genome:local exon 124414 124450 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 124451 124452 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 124451 230306 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 230305 230306 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 230307 230320 . + . NIVO01055543.1 exonerate:protein2genome:local exon 230307 230320 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 230321 230322 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 230321 270635 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 270634 270635 . + . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 270636 270678 . + . NIVO01055543.1 exonerate:protein2genome:local exon 270636 270678 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 270679 270680 . + . intron_id 3 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 270679 315648 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 315647 315648 . + . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 315649 315704 . + . NIVO01055543.1 exonerate:protein2genome:local exon 315649 315704 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 315705 315706 . + . intron_id 4 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 315705 350208 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 350207 350208 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 350209 350240 . + . NIVO01055543.1 exonerate:protein2genome:local exon 350209 350240 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 350241 350242 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 350241 403818 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 403817 403818 . + . intron_id 4 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 403819 403830 . + . NIVO01055543.1 exonerate:protein2genome:local exon 403819 403830 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 403831 403832 . + . intron_id 6 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 403831 408886 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 408885 408886 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 408887 408895 . + . NIVO01055543.1 exonerate:protein2genome:local exon 408887 408895 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 408896 408897 . + . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 408896 416996 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 416995 416996 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 416997 417046 . + . NIVO01055543.1 exonerate:protein2genome:local exon 416997 417046 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 417047 417048 . + . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 417047 559034 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 559033 559034 . + . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 559035 559081 . + . NIVO01055543.1 exonerate:protein2genome:local exon 559035 559081 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 559082 559083 . + . intron_id 9 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 559082 601359 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 601358 601359 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 601360 601368 . + . NIVO01055543.1 exonerate:protein2genome:local exon 601360 601368 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 601369 601370 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 601369 689237 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 689236 689237 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 689238 689248 . + . NIVO01055543.1 exonerate:protein2genome:local exon 689238 689248 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 689249 689250 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 689249 778510 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 778509 778510 . + . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 778511 778524 . + . NIVO01055543.1 exonerate:protein2genome:local exon 778511 778524 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 778525 778526 . + . intron_id 12 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 778525 824879 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 824878 824879 . + . intron_id 11 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local cds 824880 824898 . + . NIVO01055543.1 exonerate:protein2genome:local exon 824880 824898 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 824899 824900 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 824899 877473 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 877472 877473 . + . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 877474 877519 . + . NIVO01055543.1 exonerate:protein2genome:local exon 877474 877519 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 877520 877521 . + . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 877520 1021400 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 1021399 1021400 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1021401 1021417 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1021401 1021417 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1021418 1021419 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1021418 1036213 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 1036212 1036213 . + . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1036214 1036243 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1036214 1036243 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1036244 1036245 . + . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1036244 1085360 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 1085359 1085360 . + . intron_id 15 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 1085361 1085372 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1085361 1085372 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1085373 1085374 . + . intron_id 17 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1085373 1150969 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 1150968 1150969 . + . intron_id 16 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1150970 1151042 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1150970 1151042 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 124414 1151042 113 + . alignment_id 8 ; Query SPP00000005_1.0 ; Align 124414 4 36 ; Align 230309 17 12 ; Align 270636 21 42 ; Align 315651 36 54 ; Align 350209 54 30 ; Align 403820 65 9 ; Align 408888 69 6 ; Align 416998 72 48 ; Align 559037 89 45 ; Align 601360 104 9 ; Align 689238 107 9 ; Align 778512 111 12 ; Align 824882 116 15 ; Align 877475 122 45 ; Align 1021401 137 15 ; Align 1036215 143 27 ; Align 1085362 153 9 ; Align 1150971 157 72 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 109 Query range: 10 -> 176 Target range: 82468 -> 1136373 11 : LeuSerAlaIleSerLeuAspGlyGluLysValAspPhe >>>> Target Int : 24 ::::::::: ...:::||||||||| |||::: 8204 b IleThrSerTrpGluIleAspGlyGluThrValGluThr++ 82469 : atcacttcttgggaaatagatggggaaacagtggaaacagt............... : 82510 25 : ron 1 >>>> >>>> Target Intron 2 >>>> AsnThrPheArgGly : 28 p 97302 bp :!!!:!!:!||| ! ++++ ++HisSerTyrArgPro 82511 : ..........aggt.........................agCATAGTTATAGGCCA : 188026 29 : ArgAlaValLeuIleGluAsn >>>> Target Intron 3 >>>> ValAla : 37 !.!|||||| !|||:!!.!. 137015 bp ||| !! AsnAlaValAlaIleGlnGlu++ ++ValPro 188027 : AATGCCGTGGCCATTCAAGAAgt.........................agGTACCT : 325068 38 : Ser{Le} >>>> Target Intron 4 >>>> {u}UnkGlyThrThrThrAr : 45 ..!{ } 70551 bp {!} ...::: || Gln{Ar}++ ++{g}GlySerSerArgProAr 325069 : CAG{AG}gt.........................ag{g}ggatcttcccgacccag : 395643 46 : gAspPheThrGlnLeuAsnGluLeuGlnCysArgPhe{Pr} >>>> Target I : 58 |||| |||...:::::: :::...||| { } 3133 gAspArgThrHisIleSerTyrIleSerCysIleGly{Ar}++ 395644 : ggatcgaacccacatttcttacatctcctgcattggc{ag}gt............. : 395686 59 : ntron 5 >>>> {o}ArgArgLeuValValLeuGlyPheProCysAsnGlnPhe : 71 3 bp {!}..!|||:!!||| !|||! ! ! !|||!!.::!.!. ++{g}GluArgValValSerLeuValAsnTyrCysLysArgMet 395687 : ............ag{G}GAGAGAGTTGTATCTCTGGTAAACTATTGTAAAAGAATG : 427054 72 : GlyHisGlnGluAsnCysGlnAsnGluGluIleLeuAsnSerLeu{Ly} >>>> : 87 ! !....!.||| ::! ||| !|||! !|||{!.} ThrSerSerHisAsnLeuCysSerCysGluCysLeuMetHisLeu{Se}++ 427055 : ACTTCTAGTCATAACCTGTGTTCCTGTGAGTGTCTGATGCACCTC{AG}gt..... : 427106 88 : Target Intron 6 >>>> {s}Tyr{Va} >>>> Target Intron 7 > : 89 10995 bp {.}|||{:!} 7299 bp ++{r}Tyr{Le}++ 427107 : ....................ag{c}tat{tt}gt...................... : 438107 90 : >>> {l}ArgProGlyGlyGlyTyrGlnProThrPheThrLeuValGlnLysCys : 105 {!}|||||| !||| ||| ... |||::!|||::! ! ++{u}ArgProProGlyLeuLeuLeuProLeuLeuLeuLeuMetGlnArgLeu 438108 : ...ag{G}AGACCCCCGGGCCTtttgctgccactgctgctgcttatGCAGCGGCTC : 445450 106 : GluVal{As} >>>> Target Intron 8 >>>> {n}GlyGlnAsnGluHi : 113 ..!! !{||} 26920 bp {|} :::||| || ArgGly{As}++ ++{n}PheLysAsnValHi 445451 : CGGGGA{AA}gt.........................ag{t}tttaaaaatgtgca : 472394 114 : s{P} >>>> Target Intron 9 >>>> {ro}ValPheAlaTyrLeu >> : 120 |{ } 161870 bp { !}:::||| s{L}++ ++{ys}IlePheProIleGln++ 472395 : C{A}gt.........................ag{ag}atcttcccgatccaggt.. : 634287 121 : >> Target Intron 10 >>>> LysAspLysLeuProTyrProTyrAsp{A} : 129 156967 bp |||...|||||| ...{|} ++AlaAspSerLeuProThrGluLeuSer{A} 634288 : ........................aggcagattctttaccaactgagctatca{g} : 791279 130 : >>>> Target Intron 11 >>>> {sp}ProPhe{S} >>>> Target : 132 66427 bp {||}||||||{|} 5 +- ++{sp}ProPhe{S}++ 791280 : ga..........................ag{AT}CCATTC{T}gt........... : 857718 133 : Intron 12 >>>> {er}LeuMetThrAspProLysLeuIle{Il} >>>> : 141 827 bp {||}! !:!:|||..!|||!!.!!!:!!{||} ++{er}SerLeuThrSerProAsnPheLeu{Il}++ 857719 : ...............ag{CC}TCTCTAACTTCCCCGAATTTTCTT{AT}gt..... : 863573 142 : Target Intron 13 >>>> {e}TrpSerProValArgArgSer{A} >>>> : 149 33982 bp {|}|||:!!! ! !|||!.!.!!{!} ++{e}TrpThrHisLysArgAsnGly{G}++ 863574 : .....................ag{c}tggaCGCATAAGAGAAACGGA{G}gt.... : 897578 150 : Target Intron 14 >>>> {sp}ValAlaTrp >>>> Target Intro : 153 28977 bp {!:}! !! !||| 102177 b ++{lu}GlyAspTrp++ 897579 : ......................ag{AG}GGAGACTGGgt................. : 926566 154 : n 15 >>>> AsnPheGluLysPheLeu >>>> Target Intron 16 >>> : 159 p ||||||...:::|||::: 44038 bp ++AsnPheSerGlnPheIle++ 926567 : .........agaatttttcacagtttattgt......................... : 1028761 160 : > IleGlyProGluGly{G} >>>> Target Intron 17 >>>> {lu}P : 165 :!!..!|||::: {|} 63523 bp {||} ++ValSerProLysThr{G}++ ++{lu}G 1028762 : .agGTTTCTCCcaagaca{g}gt..........................ag{AA}G : 1136338 166 : roPheArgArgTyrSerArgThrPheProThrIle : 176 !|||!.! !|||!!!..! !|||||| !:!! lyPheAsnLeuTyrThrGluHisPheProTrpVal 1136339 : GATTTAATTTGTATACTGAACATTTTCCTTGGGTA : 1136373 vulgar: SPP00000005_1.0 10 176 . NIVO01055543.1 82468 1136373 + 109 M 13 39 5 0 2 I 0 8200 3 0 2 5 0 2 I 0 97298 3 0 2 M 12 36 5 0 2 I 0 137011 3 0 2 M 3 9 S 0 2 5 0 2 I 0 70547 3 0 2 S 1 1 M 18 54 S 0 2 5 0 2 I 0 31329 3 0 2 S 1 1 M 28 84 S 0 2 5 0 2 I 0 10991 3 0 2 S 1 1 M 1 3 S 0 2 5 0 2 I 0 7295 3 0 2 S 1 1 M 18 54 S 0 2 5 0 2 I 0 26916 3 0 2 S 1 1 M 5 15 S 0 1 5 0 2 I 0 161866 3 0 2 S 1 2 M 5 15 5 0 2 I 0 156963 3 0 2 M 9 27 S 0 1 5 0 2 I 0 66423 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 5823 3 0 2 S 1 2 M 8 24 S 0 2 5 0 2 I 0 33978 3 0 2 S 1 1 M 7 21 S 0 1 5 0 2 I 0 28973 3 0 2 S 1 2 M 3 9 5 0 2 I 0 102173 3 0 2 M 6 18 5 0 2 I 0 44034 3 0 2 M 5 15 S 0 1 5 0 2 I 0 63519 3 0 2 S 1 2 M 12 36 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 82469 1136373 109 + . gene_id 9 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 82469 82507 . + . NIVO01055543.1 exonerate:protein2genome:local exon 82469 82507 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 82508 82509 . + . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 82508 90711 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 90710 90711 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 90712 90713 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 90712 188013 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 188012 188013 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 188014 188049 . + . NIVO01055543.1 exonerate:protein2genome:local exon 188014 188049 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 188050 188051 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 188050 325064 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 325063 325064 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 325065 325075 . + . NIVO01055543.1 exonerate:protein2genome:local exon 325065 325075 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 325076 325077 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 325076 395626 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 395625 395626 . + . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 395627 395683 . + . NIVO01055543.1 exonerate:protein2genome:local exon 395627 395683 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 395684 395685 . + . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 395684 427016 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 427015 427016 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 427017 427103 . + . NIVO01055543.1 exonerate:protein2genome:local exon 427017 427103 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 427104 427105 . + . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 427104 438098 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 438097 438098 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 438099 438104 . + . NIVO01055543.1 exonerate:protein2genome:local exon 438099 438104 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 438105 438106 . + . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 438105 445403 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 445402 445403 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 445404 445460 . + . NIVO01055543.1 exonerate:protein2genome:local exon 445404 445460 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 445461 445462 . + . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 445461 472380 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 472379 472380 . + . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 472381 472397 . + . NIVO01055543.1 exonerate:protein2genome:local exon 472381 472397 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 472398 472399 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 472398 634267 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 634266 634267 . + . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 634268 634284 . + . NIVO01055543.1 exonerate:protein2genome:local exon 634268 634284 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 634285 634286 . + . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 634285 791251 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 791250 791251 . + . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 791252 791279 . + . NIVO01055543.1 exonerate:protein2genome:local exon 791252 791279 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 791280 791281 . + . intron_id 11 ; splice_site "ga" NIVO01055543.1 exonerate:protein2genome:local intron 791280 857706 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 857705 857706 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 857707 857715 . + . NIVO01055543.1 exonerate:protein2genome:local exon 857707 857715 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 857716 857717 . + . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 857716 863542 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 863541 863542 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 863543 863570 . + . NIVO01055543.1 exonerate:protein2genome:local exon 863543 863570 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 863571 863572 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 863571 897552 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 897551 897552 . + . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 897553 897575 . + . NIVO01055543.1 exonerate:protein2genome:local exon 897553 897575 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 897576 897577 . + . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 897576 926552 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 926551 926552 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 926553 926563 . + . NIVO01055543.1 exonerate:protein2genome:local exon 926553 926563 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 926564 926565 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 926564 1028740 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 1028739 1028740 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1028741 1028758 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1028741 1028758 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1028759 1028760 . + . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1028759 1072796 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 1072795 1072796 . + . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1072797 1072812 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1072797 1072812 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1072813 1072814 . + . intron_id 17 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1072813 1136335 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 1136334 1136335 . + . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1136336 1136373 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1136336 1136373 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 82469 1136373 109 + . alignment_id 9 ; Query SPP00000005_1.0 ; Align 82469 11 39 ; Align 188014 24 36 ; Align 325065 36 9 ; Align 395628 40 54 ; Align 427018 59 84 ; Align 438100 88 3 ; Align 445405 90 54 ; Align 472382 109 15 ; Align 634270 115 15 ; Align 791252 120 27 ; Align 857709 130 6 ; Align 863545 133 24 ; Align 897554 142 21 ; Align 926555 150 9 ; Align 1028741 153 18 ; Align 1072797 159 15 ; Align 1136338 165 36 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 105 Query range: 23 -> 185 Target range: 34214 -> 893252 24 : AsnThrPheArgGlyArgAlaValLeuIleGluAsnValAlaSerLeuUnkGly{Th} : 42 !:!|||! !||||||! !||||||! !!!:!..||| !!!!! ! |||{.!} SerThrSerSerGlyArgGluValLeuThrAspArgValLeuThrCysLeuGly{Al} 34215 : AGCACGTCATCGGGGAGGGAGGTATTGACAGACAGGGTTCTCACCTGCCTAGGG{GC} : 34269 43 : >>>> Target Intron 1 >>>> {r}ThrThrArgAspPheThrGlnLeuAs : 51 7742 bp {!}||| !! ! !|||:!!|||! !.! ++ ++{a}ThrLeuProThrPheSerGlnSerGl 34270 : gt.........................ag{A}ACTCTCCCCACCTTCTCACAATCTCA : 42038 52 : nGluLeuGlnCysArg >>>> Target Intron 2 >>>> PheProArgArgL : 61 . !! !:!!! !||| 46904 bp |||||| | nThrHisGluTyrArg++ ++ThrProArgCysL 42039 : AACACATGAGTACAGAgt.........................agactccaagatgtc : 88972 62 : euValVal{L} >>>> Target Intron 3 >>>> {eu}GlyPheProCysAs : 69 ||...:::{ } 47625 bp { !} !! |||||| euAlaLeu{A}++ ++{la}HisSerProCysVa 88973 : tggctcta{g}gt.........................ag{CC}CACTCACCCTGTGT : 136621 70 : nGlnPheGlyHisGlnGlu{A} >>>> Target Intron 4 >>>> {sn}Cys : 77 |||!:! !! !::!:!!{!} 30546 bp {:!}||| lGlnTyrTrpThrArgGln{S}++ ++{er}Cys 136622 : ACAATATTGGACCAGACAA{A}gt.........................ag{GC}TGC : 167191 78 : GlnAsn{G} >>>> Target Intron 5 >>>> {lu}GluIleLeuAsnSerL : 86 |||!!.{|} 23045 bp {||}... :::||||||: GlnLys{G}++ ++{lu}AsnSerValAsnSerM 167192 : CAGAAA{G}gt.........................ag{aa}aactctgtgaacagta : 190263 87 : euLysTyrValArg{Pr} >>>> Target Intron 6 >>>> {o}GlyGlyGl : 94 ::||| :::{ } 6000 bp {!} ..!|| etLysArgGlnLys{Ar}++ ++{g}GluAlaGl 190264 : tgaagaggcaaaaa{ag}gt.........................ag{g}gaagcTGG : 196287 95 : yTyrGlnProThrPheThrLeu{Va} >>>> Target Intron 7 >>>> {l} : 102 | :!! !|||||| !! !{:!} 81382 bp {!} yProGluAsnThrPheCysSer{Il}++ ++{e} 196288 : TCCAGAGAATACATTTTGTTCC{AT}gt.........................ag{A} : 277695 103 : GlnLys{Cy} >>>> Target Intron 8 >>>> {s}GluValAsn >>>> : 109 ||||||{||} 148820 bp {|}||||||!.! GlnLys{Cy}++ ++{s}GluValThr+- 277696 : CAGAAG{TG}gt.........................ag{t}gaaGTAACTga..... : 426536 110 : Target Intron 9 >>>> GlyGlnAsnGluHisProValPheAlaTyrLeuLys : 120 32456 bp |||...||| ||||||::: ||| ++GlySerAsnProHisProLeuCysLeuLeuLeuTrp 426537 : ....................agggatcgaatccacaccccctgtgtctcctgctttgg : 459023 121 : Asp >>>> Target Intron 10 >>>> LysLeuProTyrProTyrAspAspP : 130 ... 26167 bp :::||| ! |||! !! Gln++ ++GluLeuLysMetProSerHisThrT 459024 : caggt..........................aggagcTTAAAATGCCCTCACATACAA : 485220 131 : roPheSerLeuMetThr >>>> Target Intron 11 >>>> AspProLysLe : 139 !!|||! !:!!...!.! 13209 bp !!! !:! hrPheIleIleGlnAsn++ ++ArgSerMetIl 485221 : CTTTCATTATTCAAAATgt..........................agAGATCCATGAT : 498456 140 : uIleIleTrpSerProValArgArgSerAspVal >>>> Target Intron 12 : 151 !.!!! !|||!!!|||:!!! !|||..!! ||| 82610 bp ePheAsnTrpThrProIleProArgGlnGlyVal+- 498457 : ATTCAACTGGACTCCTATCCCAAGGCAGGGAGTGgg...................... : 498494 152 : >>>> AlaTrpAsnPheGluLysPheLeuIleGlyPro{G} >>>> Target In : 162 |||..!||| ! |||! !!!: ! !{|} 53132 ++PheTrpGlyPheLeuAspPheSerMetLysLys{G}++ 498495 : ....agttttggggTTTCCTTGATTTCTCAATGAAGAAA{G}gt.............. : 581138 163 : tron 13 >>>> {lu}GlyGluProPheArg >>>> Target Intron 14 > : 168 bp {||} |||...::: 195264 bp ++{lu}IlePheProIleGln++ 581139 : ............ag{ag}atcttcccgatccaggt....................... : 634287 169 : >>> ArgTyrSerArg{T} >>>> Target Intron 15 >>>> {hr}PheP : 174 ||||||||||||{!} 63650 bp { !}||| ++ArgTyrSerArg{L}-+ ++{ys}PheS 634288 : ...agAGATACAGCAGA{A}at..........................ag{aa}tttt : 893217 175 : roThrIleAsnIleGluProAspIleLysArgLeu : 185 |||:::::: :::||| :::|||||| erThrValHisCysAspProHisSerGlnArgLeu 893218 : ccacagttcattgtgatccacacagtcaacggctt : 893252 vulgar: SPP00000005_1.0 23 185 . NIVO01055543.1 34214 893252 + 105 M 18 54 S 0 2 5 0 2 I 0 7738 3 0 2 S 1 1 M 14 42 5 0 2 I 0 46900 3 0 2 M 7 21 S 0 1 5 0 2 I 0 47621 3 0 2 S 1 2 M 11 33 S 0 1 5 0 2 I 0 30542 3 0 2 S 1 2 M 3 9 S 0 1 5 0 2 I 0 23041 3 0 2 S 1 2 M 10 30 S 0 2 5 0 2 I 0 5996 3 0 2 S 1 1 M 10 30 S 0 2 5 0 2 I 0 81378 3 0 2 S 1 1 M 2 6 S 0 2 5 0 2 I 0 148816 3 0 2 S 1 1 M 3 9 5 0 2 I 0 32452 3 0 2 M 13 39 5 0 2 I 0 26163 3 0 2 M 14 42 5 0 2 I 0 13205 3 0 2 M 15 45 5 0 2 I 0 82606 3 0 2 M 11 33 S 0 1 5 0 2 I 0 53128 3 0 2 S 1 2 M 5 15 5 0 2 I 0 195260 3 0 2 M 4 12 S 0 1 5 0 2 I 0 63646 3 0 2 S 1 2 M 13 39 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 34215 893252 105 + . gene_id 10 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 34215 34270 . + . NIVO01055543.1 exonerate:protein2genome:local exon 34215 34270 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 34271 34272 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 34271 42012 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 42011 42012 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 42013 42055 . + . NIVO01055543.1 exonerate:protein2genome:local exon 42013 42055 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 42056 42057 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 42056 88959 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 88958 88959 . + . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 88960 88981 . + . NIVO01055543.1 exonerate:protein2genome:local exon 88960 88981 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 88982 88983 . + . intron_id 3 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 88982 136606 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 136605 136606 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 136607 136642 . + . NIVO01055543.1 exonerate:protein2genome:local exon 136607 136642 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 136643 136644 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 136643 167188 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 167187 167188 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 167189 167200 . + . NIVO01055543.1 exonerate:protein2genome:local exon 167189 167200 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 167201 167202 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 167201 190245 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 190244 190245 . + . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 190246 190279 . + . NIVO01055543.1 exonerate:protein2genome:local exon 190246 190279 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 190280 190281 . + . intron_id 6 ; splice_site "gT" NIVO01055543.1 exonerate:protein2genome:local intron 190280 196279 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 196278 196279 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 196280 196312 . + . NIVO01055543.1 exonerate:protein2genome:local exon 196280 196312 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 196313 196314 . + . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 196313 277694 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 277693 277694 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 277695 277703 . + . NIVO01055543.1 exonerate:protein2genome:local exon 277695 277703 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 277704 277705 . + . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 277704 426523 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 426522 426523 . + . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 426524 426533 . + . NIVO01055543.1 exonerate:protein2genome:local exon 426524 426533 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 426534 426535 . + . intron_id 9 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 426534 458989 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 458988 458989 . + . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 458990 459028 . + . NIVO01055543.1 exonerate:protein2genome:local exon 458990 459028 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 459029 459030 . + . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 459029 485195 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 485194 485195 . + . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 485196 485237 . + . NIVO01055543.1 exonerate:protein2genome:local exon 485196 485237 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 485238 485239 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 485238 498446 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 498445 498446 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 498447 498491 . + . NIVO01055543.1 exonerate:protein2genome:local exon 498447 498491 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 498492 498493 . + . intron_id 12 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 498492 581101 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 581100 581101 . + . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 581102 581135 . + . NIVO01055543.1 exonerate:protein2genome:local exon 581102 581135 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 581136 581137 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 581136 634267 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 634266 634267 . + . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 634268 634284 . + . NIVO01055543.1 exonerate:protein2genome:local exon 634268 634284 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 634285 634286 . + . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 634285 829548 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 829547 829548 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 829549 829561 . + . NIVO01055543.1 exonerate:protein2genome:local exon 829549 829561 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 829562 829563 . + . intron_id 15 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 829562 893211 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 893210 893211 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 893212 893252 . + . NIVO01055543.1 exonerate:protein2genome:local exon 893212 893252 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 34215 893252 105 + . alignment_id 10 ; Query SPP00000005_1.0 ; Align 34215 24 54 ; Align 42014 43 42 ; Align 88960 57 21 ; Align 136609 65 33 ; Align 167191 77 9 ; Align 190248 81 30 ; Align 196281 92 30 ; Align 277696 103 6 ; Align 426525 106 9 ; Align 458990 109 39 ; Align 485196 122 42 ; Align 498447 136 45 ; Align 581102 151 33 ; Align 634270 163 15 ; Align 829549 168 12 ; Align 893214 173 39 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 106 Query range: 2 -> 161 Target range: 203525 -> 1208121 3 : PheIleAlaLysSerPheTyrAspLeuSerAlaIleSer{Le} >>>> Target : 16 .!!|||||| !..!|||||| ! ||||||:!!:!:..!{ } 64 IleIleAlaProGluPheTyrLysLeuSerSerLeuGln{Gl}+- 203526 : ATTATTGCTCCAGAGTTTTATAAACTATCTTCTTTGCAA{GG}ga........... : 203569 17 : Intron 1 >>>> {u}AspGlyGluLysValAspPheAsnThrPhe{Ar} > : 27 248 bp {!}.!.|||:!!!:!:!!|||||| !!:!{||} ++{y}GlnGlyGlnArgLeuAspPheLeuLeuTyr{Ar}++ 203570 : ..............ag{C}CAAGGGCAAAGGTTAGATTTTTTACTGTAC{AG}gt. : 267850 28 : >>> Target Intron 2 >>>> {g}GlyArgAlaValLeuIleGluAsnVal : 36 96064 bp {|}..!|||:!! ! ! |||::: ! ++{g}AsnArgSerCysAspTrpGluSerSer 267851 : ........................ag{A}AACAGATCTTGTGACTGGGAGTCAAGT : 363937 37 : AlaSerLeuUnkGlyThrThrThr{Ar} >>>> Target Intron 3 >>>> : 45 !.!|||! ! |||!:!! !!:!{||} 3388 bp ValSerCysLeuGlySerIleSer{Ar}+- + 363938 : GTAAGTTGTCTGGGAAGTATAAGT{AG}gg.........................a : 367352 46 : {g}AspPheThrGlnLeuAsnGluLeuGlnCysArgPheProArg{Ar} >>>> : 60 {|}::: ||||||:::::::::::: |||||| {||} +{g}AsnArgThrGlnValSerAspIleAlaGlyArgPhePheThr{Ar}-+ 367353 : g{g}aatcgaacccaggtctccgacattgcaggcagattctttacc{ag}ct.... : 367401 61 : Target Intron 4 >>>> {g}LeuValValLeuGlyPheProCysAsnGln : 70 4728 bp {|}||| ! !||| ! ||||||.!. ! ++{g}LeuTyrCysLeuGlnGlyProCysGlnGly 367402 : .....................ag{G}TTGTACTGTCTCCAAGGGCCCTGCCAAGGA : 372155 71 : Phe{Gl} >>>> Target Intron 5 >>>> {y}HisGlnGluAsnCysGl : 78 |||{ } 76261 bp {!}|||:::......|||:: Phe{Th}++ ++{r}HisLysSerLysCysLy 372156 : TTC{AC}gt.........................ag{t}cataaaagcaaatgtaa : 448440 79 : nAsnGluGlu >>>> Target Intron 6 >>>> IleLeuAsnSerLeuLy : 87 :|||:::... 15478 bp ||| !..!!!!:!!.. sAsnLysHis++ ++IleThrGlyCysValSe 448441 : aaataaacatgt.........................agaTTACTGGTTGTGTTTC : 463945 88 : s{T} >>>> Target Intron 7 >>>> {yr}ValArgProGlyGlyGlyT : 95 .{!} 22884 bp {::} |||... ||| r{T}+- ++{rp}GluLeuProAsnProGlyI 463946 : C{T}ga.........................ag{gg}gagcttcccaacccaggga : 486853 96 : yrGlnProThrPheThrLeuValGln >>>> Target Intron 8 >>>> L : 104 :::||| :::||| 148717 bp | leGluProArgSerProThrLeuGln++ ++L 486854 : tagaacccaggtctcccacattgcaggt.........................agA : 635597 105 : ysCysGluVal{As} >>>> Target Intron 9 >>>> {n}GlyGlnAsn : 111 |||||||| !{||} 74190 bp {|} ! ||| ysCysGluLys{As}++ ++{n}LysThrAsn 635598 : AATGTGAAAAG{AA}gt.........................ag{C}AAAacaaat : 709808 112 : GluHisPro{V} >>>> Target Intron 10 >>>> {al}PheAlaTyrL : 119 ||| |||{!} 87549 bp { !} |||::: GluProPro{G}+- ++{ly}AlaAlaTrpG 709809 : gagccacca{g}gg..........................ag{GG}GCAgcatggg : 797381 120 : euLysAsp{Ly} >>>> Target Intron 11 >>>> {s}LeuProTyrPr : 126 ||| {||} 32603 bp {|}||||||:::|| luLysLys{Ly}++ ++{s}LeuProHisPr 797382 : agaaaaaa{aa}gt..........................ag{g}ctcccccatcc : 830005 127 : oTyrAspAspPro{P} >>>> Target Intron 12 >>>> {he}SerLeu : 133 | ||| |||{ } 67532 bp { !}...! ! o***AspPhePro{A}++ ++{la}GlyArg 830006 : ataggattttcca{g}gt..........................ag{ct}ggaCGC : 897558 134 : MetThrAspProLys >>>> Target Intron 13 >>>> LeuIleIleTr : 142 !!:! !!!: !!:!! 63083 bp |||:!!||||| IleArgGluThrGlu++ ++LeuLeuIleTr 897559 : ATAAGAGAAACGGAGgt..........................agCTCCTAATATG : 960668 143 : p >>>> Target Intron 14 >>>> SerProValArgArgSer{A} >> : 149 | 197150 bp ||||||:!!|||!:!..!{!} p++ ++SerProIleArgLysGln{G}+- 960669 : Ggt..........................agAGTCCAATAAGAAAACAA{G}ga.. : 1157842 150 : >> Target Intron 15 >>>> {sp}ValAlaTrpAsnPheGluLysPheLe : 158 50244 bp { }::: ||| |||||| |||.. +-{ly}LeuLeuTrpLeuPheGluGlyPhePh 1157843 : ........................aa{ga}ttgctttggctatttgagggtttttt : 1208110 159 : uIleGlyPro : 161 .::: ||| eValPhePro 1208111 : tgtatttcca : 1208121 vulgar: SPP00000005_1.0 2 161 . NIVO01055543.1 203525 1208121 + 106 M 13 39 S 0 2 5 0 2 I 0 64244 3 0 2 S 1 1 M 10 30 S 0 2 5 0 2 I 0 96060 3 0 2 S 1 1 M 17 51 S 0 2 5 0 2 I 0 3384 3 0 2 S 1 1 M 14 42 S 0 2 5 0 2 I 0 4724 3 0 2 S 1 1 M 11 33 S 0 2 5 0 2 I 0 76257 3 0 2 S 1 1 M 9 27 5 0 2 I 0 15474 3 0 2 M 6 18 S 0 1 5 0 2 I 0 22880 3 0 2 S 1 2 M 15 45 5 0 2 I 0 148713 3 0 2 M 4 12 S 0 2 5 0 2 I 0 74186 3 0 2 S 1 1 M 6 18 S 0 1 5 0 2 I 0 87545 3 0 2 S 1 2 M 6 18 S 0 2 5 0 2 I 0 32599 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 67528 3 0 2 S 1 2 M 7 21 5 0 2 I 0 63079 3 0 2 M 4 12 5 0 2 I 0 197146 3 0 2 M 6 18 S 0 1 5 0 2 I 0 50240 3 0 2 S 1 2 M 12 36 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 203526 1208121 106 + . gene_id 11 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 203526 203566 . + . NIVO01055543.1 exonerate:protein2genome:local exon 203526 203566 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 203567 203568 . + . intron_id 1 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 203567 267814 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 267813 267814 . + . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 267815 267847 . + . NIVO01055543.1 exonerate:protein2genome:local exon 267815 267847 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 267848 267849 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 267848 363911 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 363910 363911 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 363912 363965 . + . NIVO01055543.1 exonerate:protein2genome:local exon 363912 363965 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 363966 363967 . + . intron_id 3 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 363966 367353 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 367352 367353 . + . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 367354 367398 . + . NIVO01055543.1 exonerate:protein2genome:local exon 367354 367398 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 367399 367400 . + . intron_id 4 ; splice_site "ct" NIVO01055543.1 exonerate:protein2genome:local intron 367399 372126 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 372125 372126 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 372127 372162 . + . NIVO01055543.1 exonerate:protein2genome:local exon 372127 372162 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 372163 372164 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 372163 448423 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 448422 448423 . + . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 448424 448451 . + . NIVO01055543.1 exonerate:protein2genome:local exon 448424 448451 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 448452 448453 . + . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 448452 463929 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 463928 463929 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 463930 463948 . + . NIVO01055543.1 exonerate:protein2genome:local exon 463930 463948 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 463949 463950 . + . intron_id 7 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 463949 486832 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 486831 486832 . + . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 486833 486879 . + . NIVO01055543.1 exonerate:protein2genome:local exon 486833 486879 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 486880 486881 . + . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 486880 635596 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 635595 635596 . + . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 635597 635610 . + . NIVO01055543.1 exonerate:protein2genome:local exon 635597 635610 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 635611 635612 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 635611 709800 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 709799 709800 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 709801 709820 . + . NIVO01055543.1 exonerate:protein2genome:local exon 709801 709820 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 709821 709822 . + . intron_id 10 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 709821 797369 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 797368 797369 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 797370 797391 . + . NIVO01055543.1 exonerate:protein2genome:local exon 797370 797391 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 797392 797393 . + . intron_id 11 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 797392 829994 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 829993 829994 . + . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 829995 830020 . + . NIVO01055543.1 exonerate:protein2genome:local exon 829995 830020 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 830021 830022 . + . intron_id 12 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 830021 897552 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 897551 897552 . + . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 897553 897575 . + . NIVO01055543.1 exonerate:protein2genome:local exon 897553 897575 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 897576 897577 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 897576 960658 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 960657 960658 . + . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 960659 960670 . + . NIVO01055543.1 exonerate:protein2genome:local exon 960659 960670 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 960671 960672 . + . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 960671 1157820 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 1157819 1157820 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1157821 1157839 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1157821 1157839 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1157840 1157841 . + . intron_id 15 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 1157840 1208083 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 1208082 1208083 . + . intron_id 14 ; splice_site "aa" NIVO01055543.1 exonerate:protein2genome:local cds 1208084 1208121 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1208084 1208121 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 203526 1208121 106 + . alignment_id 11 ; Query SPP00000005_1.0 ; Align 203526 3 39 ; Align 267816 17 30 ; Align 363913 28 51 ; Align 367355 46 42 ; Align 372128 61 33 ; Align 448425 73 27 ; Align 463930 82 18 ; Align 486835 89 45 ; Align 635597 104 12 ; Align 709802 109 18 ; Align 797372 116 18 ; Align 829996 123 24 ; Align 897555 132 21 ; Align 960659 139 12 ; Align 1157821 143 18 ; Align 1208086 150 36 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 104 Query range: 3 -> 167 Target range: 69046 -> 1242649 4 : IleAlaLysSerPheTyrAspLeuSerAlaIle{S} >>>> Target Intron : 15 ||| !|||!.!.!! ! ||||||.!!::!|||{ } 1846 bp IleAsnLysLysLeuGlnAspLeuGlySerIle{A}++ 69047 : ATCAACAAAAAGCTCCAGGATCTTGGCAGTATT{C}gt.................. : 69083 16 : 1 >>>> {er}LeuAspGly{G} >>>> Target Intron 2 >>>> {l : 19 {!!}|||!!:|||{|} 142578 bp {| ++{rg}LeuGluGly{G}++ ++{l 69084 : .......ag{gT}CTAGAAGGG{G}gt.........................ag{A : 213517 20 : u}{L} >>>> Target Intron 3 >>>> {ys}ValAspPheAsn{Th} : 25 |}{:} 119780 bp {!!}:!!||||||:!!{! } u}{G}++ ++{lu}IleAspPheHis{Ar}++ 213518 : A}{G}gt.........................ag{AA}ATTGATTTTCAT{AG}gt : 333316 26 : >>>> Target Intron 4 >>>> {r}PheArg{G} >>>> Target Int : 28 168790 bp {!} !:!{|} 91900 ++{g}GlyLys{G}++ 333317 : .........................ag{A}GGGAAA{G}gt............... : 502116 29 : ron 5 >>>> {ly}ArgAlaValLeu{I} >>>> Target Intron 6 >> : 33 bp {||} ||||||{ } 25561 bp ++{ly}CysLeuValLeu{A}++ 502117 : ..........ag{ga}tgtctggttcta{g}gt....................... : 594031 34 : >> {le}GluAsnValAlaSerLeuUnk{Gl} >>>> Target Intron 7 : 41 { !}|||||| !!::!..!||| {||} 44637 bp ++{sp}GluAsnPheSerGluLeuGly{Gl}-+ 594032 : ..ag{AT}GAGAATTTCAGTGAGCTTGGA{GG}at..................... : 619617 42 : >>>> {y}ThrThrThrArgAspPheThrGlnLeuAsnGluLeuGlnCys >>> : 56 {|}.!!||||||||||||.!. !||| ! !!..!|||.!. ++{y}AlaThrThrArgAspIleHisGlnAlaTyrArgLeuAsnGlu++ 619618 : ....ag{A}GCTACCACTAGAGATATACACCAAGCATACAGGCTCAATGAGgt... : 664297 57 : > Target Intron 8 >>>> ArgPhePro{A} >>>> Target Intron : 59 165716 bp ||||||{ } 96534 bp ++AspPhePro{G}++ 664298 : ......................aggattttcca{g}gt.................. : 830023 60 : 9 >>>> {rg}ArgLeu{V} >>>> Target Intron 10 >>>> {al} : 62 {!!}||||||{|} 44119 bp {||} ++{ly}ArgLeu{V}++ ++{al} 830024 : .......ag{GG}AGACTG{G}gt..........................ag{ta} : 970683 63 : ValLeuGlyPhePro{C} >>>> Target Intron 11 >>>> {ys}AsnG : 70 :::||||||||||||{ } 64569 bp {! }|||. IleLeuGlyPhePro{G}++ ++{ly}AsnS 970684 : atcttgggcttccct{g}gt..........................ag{ga}aata : 1035275 71 : lnPheGlyHisGlnGluAsnCysGln >>>> Target Intron 12 >>>> : 79 .. ||||||::::::||| 8272 bp erAsnProHisGlnAspSerCysLeu++ ++ 1035276 : gcaaccctcaccaggattcttgcctggt..........................ag : 1043572 80 : AsnGluGluIleLeuAsnSerLeuLysTyrValArgProGly{G} >>>> Targ : 93 ||| !... |||||| !!:!!! ! !||| !!||||||{|} AsnProSerTrpLeuAsnProIleIleSerValGlyProGly{G}+- 1043573 : AATCCATCCTGGCTAAATCCTATCATCTCTGTGGGACCTGGG{G}gc......... : 1043619 94 : et Intron 13 >>>> {ly}GlyTyrGlnPro{Th} >>>> Target Int : 98 74945 bp {||}|||::: {!:} 19375 ++{ly}GlyPhePheThr{Se}++ 1043620 : .................ag{gt}ggattctttacc{ag}gt............... : 1118580 99 : ron 14 >>>> {r}PheThrLeuValGlnLysCysGluValAsnGlyGlnAsnG : 112 bp {!}|||.!!:!! !!!!.!..|||:!!:!!!.. !.!.! !: ++{r}PheAlaValPheHisSerCysGlnIleArgTyrAsnIleL 1118581 : ...........ag{C}TTTGCAGTCTTTCACAGCTGTCAAATAAGGTATAATATCA : 1137993 113 : luHisProVal{P} >>>> Target Intron 15 >>>> {he}AlaTyrLe : 119 !!||| !!.!{ } 12291 bp { }... ysHisPheAla{G}++ ++{ly}CysLeuAl 1137994 : AGCATTTCGCT{G}gt..........................ag{ga}tgtctggc : 1150305 120 : uLys{A} >>>> Target Intron 16 >>>> {sp}LysLeuProTyrPro : 126 {!} 22871 bp { }...|||||||||||| aLeu{G}++ ++{ly}AsnLeuProTyrPro 1150306 : tcta{g}gt..........................ag{gg}aatcttccctaccca : 1173197 127 : TyrAspAspProPheSerLeuMetThrAspProLysLeu{I} >>>> Target : 140 |||...|||||| ::: { } 245 GlyIleLysProMetSerLeuLysSerProAlaLeuAla{A}++ 1173198 : gggatcaaacctatgtctcttaagtctcctgcattggca{g}gt............ : 1173242 141 : Intron 17 >>>> {le}IleTrpSerProValArgArgSerAspValAlaTrp : 152 41 bp { !} |||::: ... :::::: ::: ++{sp}ProTrpThrAlaAlaTyrGlnAlaProProSerMet 1173243 : ..............ag{ac}ccctggactgcagcctaccaggctcctccgtccatg : 1197816 153 : AsnPheGlu{Ly} >>>> Target Intron 18 >>>> {s}PheLeuIleG : 160 ...|||...{!:} 44786 bp {!}||||||:::| GlyPheSer{Ar}+- ++{g}PheLeuValG 1197817 : ggattttcc{ag}gc..........................ag{g}tTCCTTgtag : 1242626 161 : lyProGluGlyGluProPheArg : 167 || :::|||...|||...::: lyGlyAspGlyAsnProLeuGln 1242627 : gaggagatggcaacccactccag : 1242649 vulgar: SPP00000005_1.0 3 167 . NIVO01055543.1 69046 1242649 + 104 M 11 33 S 0 1 5 0 2 I 0 1842 3 0 2 S 1 2 M 3 9 S 0 1 5 0 2 I 0 142574 3 0 2 S 1 3 5 0 2 I 0 119776 3 0 2 S 1 2 M 4 12 S 0 2 5 0 2 I 0 168786 3 0 2 S 1 1 M 2 6 S 0 1 5 0 2 I 0 91896 3 0 2 S 1 2 M 4 12 S 0 1 5 0 2 I 0 25557 3 0 2 S 1 2 M 7 21 S 0 2 5 0 2 I 0 44633 3 0 2 S 1 1 M 14 42 5 0 2 I 0 165712 3 0 2 M 3 9 S 0 1 5 0 2 I 0 96530 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 44115 3 0 2 S 1 2 M 5 15 S 0 1 5 0 2 I 0 64565 3 0 2 S 1 2 M 10 30 5 0 2 I 0 8268 3 0 2 M 14 42 S 0 1 5 0 2 I 0 74941 3 0 2 S 1 2 M 4 12 S 0 2 5 0 2 I 0 19371 3 0 2 S 1 1 M 17 51 S 0 1 5 0 2 I 0 12287 3 0 2 S 1 2 M 4 12 S 0 1 5 0 2 I 0 22867 3 0 2 S 1 2 M 18 54 S 0 1 5 0 2 I 0 24537 3 0 2 S 1 2 M 15 45 S 0 2 5 0 2 I 0 44782 3 0 2 S 1 1 M 11 33 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 69047 1242649 104 + . gene_id 12 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 69047 69080 . + . NIVO01055543.1 exonerate:protein2genome:local exon 69047 69080 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 69081 69082 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 69081 70926 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 70925 70926 . + . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 70927 70938 . + . NIVO01055543.1 exonerate:protein2genome:local exon 70927 70938 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 70939 70940 . + . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 70939 213516 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 213515 213516 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 213517 213519 . + . NIVO01055543.1 exonerate:protein2genome:local exon 213517 213519 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 213520 213521 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 213520 333299 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 333298 333299 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 333300 333315 . + . NIVO01055543.1 exonerate:protein2genome:local exon 333300 333315 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 333316 333317 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 333316 502105 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 502104 502105 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 502106 502113 . + . NIVO01055543.1 exonerate:protein2genome:local exon 502106 502113 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 502114 502115 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 502114 594013 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 594012 594013 . + . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 594014 594028 . + . NIVO01055543.1 exonerate:protein2genome:local exon 594014 594028 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 594029 594030 . + . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 594029 619589 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 619588 619589 . + . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 619590 619614 . + . NIVO01055543.1 exonerate:protein2genome:local exon 619590 619614 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 619615 619616 . + . intron_id 7 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 619615 664251 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 664250 664251 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 664252 664294 . + . NIVO01055543.1 exonerate:protein2genome:local exon 664252 664294 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 664295 664296 . + . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 664295 830010 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 830009 830010 . + . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 830011 830020 . + . NIVO01055543.1 exonerate:protein2genome:local exon 830011 830020 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 830021 830022 . + . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 830021 926554 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 926553 926554 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 926555 926563 . + . NIVO01055543.1 exonerate:protein2genome:local exon 926555 926563 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 926564 926565 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 926564 970682 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 970681 970682 . + . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 970683 970700 . + . NIVO01055543.1 exonerate:protein2genome:local exon 970683 970700 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 970701 970702 . + . intron_id 11 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 970701 1035269 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 1035268 1035269 . + . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1035270 1035301 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1035270 1035301 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1035302 1035303 . + . intron_id 12 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1035302 1043573 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 1043572 1043573 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1043574 1043616 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1043574 1043616 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1043617 1043618 . + . intron_id 13 ; splice_site "GC" NIVO01055543.1 exonerate:protein2genome:local intron 1043617 1118561 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 1118560 1118561 . + . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1118562 1118577 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1118562 1118577 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1118578 1118579 . + . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1118578 1137952 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 1137951 1137952 . + . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1137953 1138005 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1137953 1138005 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1138006 1138007 . + . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1138006 1150296 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 1150295 1150296 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1150297 1150311 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1150297 1150311 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1150312 1150313 . + . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1150312 1173182 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 1173181 1173182 . + . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1173183 1173239 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1173183 1173239 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1173240 1173241 . + . intron_id 17 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1173240 1197780 . + . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 1197779 1197780 . + . intron_id 16 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1197781 1197829 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1197781 1197829 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1197830 1197831 . + . intron_id 18 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 1197830 1242615 . + . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 1242614 1242615 . + . intron_id 17 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1242616 1242649 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1242616 1242649 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 69047 1242649 104 + . alignment_id 12 ; Query SPP00000005_1.0 ; Align 69047 4 33 ; Align 70929 16 9 ; Align 333302 21 12 ; Align 502107 26 6 ; Align 594016 29 12 ; Align 619592 34 21 ; Align 664253 42 42 ; Align 830011 56 9 ; Align 926557 60 6 ; Align 970685 63 15 ; Align 1035272 69 30 ; Align 1043574 79 42 ; Align 1118564 94 12 ; Align 1137954 99 51 ; Align 1150299 117 12 ; Align 1173185 122 54 ; Align 1197783 141 45 ; Align 1242617 157 33 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 100 Query range: 63 -> 187 Target range: 1268 -> 488700 64 : LeuGlyPheProCysAsnGlnPhe{G} >>>> Target Intron 1 >>>> {l : 72 |||||||||||||||...... {|} 5614 bp {| LeuGlyPheProCysGlySerThr{G}++ +-{l 1269 : ttgggctttccttgtggctcaact{g}gt.........................at{g : 6908 73 : y}HisGlnGluAsnCysGlnAsnGluGluIleLeuAsnSerLeuLysTyrValArgPr : 91 |} |||... ||| ::: |||::: ||| y}SerGlyGluGlyAsnGlyAsnProLeu***CysSerCysLeuGluAsnProArgAs 6909 : c}agtggagaaggaaatggcaacccactctagtgttcttgcctggagaatcccaggga : 6964 92 : oGlyGlyGly{Ty} >>>> Target Intron 2 >>>> {r}GlnProThrPhe : 99 ||||||...{!:} 5832 bp {:}||||||.!!.!! pGlyGlyAla{Tr}++ ++{p}GlnProAlaIle 6965 : cgggggagcc{tg}gt.........................ag{G}CAGCCAGCAATC : 12820 100 : ThrLeuVal{G} >>>> Target Intron 3 >>>> {ln}LysCysGluValA : 108 :!!:!! !{ } 8406 bp { } ||||||:!!| SerMetSer{G}++ ++{ly}LeuCysGluLeuA 12821 : TCAATGTCA{G}gt.........................ag{GC}CTCTGTGAATTGA : 21253 109 : snGly{G} >>>> Target Intron 4 >>>> {ln}Asn{Gl} >>>> Tar : 112 || !{:} 19609 bp {:!}|||{:!} snGln{A}+- ++{rg}Asn{Gl}++ 21254 : ACCAA{A}gg.........................ag{GA}AAC{CA}gt........ : 40878 113 : get Intron 5 >>>> {u}HisProValPheAlaTyrLeuLys{A} >>>> Ta : 121 49836 bp {!}:!! !:!! !!.!!:!|||..!{!} ++{n}TyrAspIleProValPheLeuSer{G}++ 40879 : .................ag{G}TATGACATACCTGTGTTTCTGTCA{G}gt....... : 90740 122 : rget Intron 6 >>>> {sp}LysLeuProTyrProTyrAspAspProPheSerL : 133 30576 bp { } |||||| ||| :::||| ||| ++{ly}HisLeuProAsnProArgIleGluProGlySerP 90741 : ..................ag{gg}catcttcccaacccaaggattgaacccgggtctc : 121349 134 : euMetThrAsp >>>> Target Intron 7 >>>> ProLysLeuIleIleTrp : 142 ... 3381 bp ||| !:!: !||| roAlaLeuGln++ ++ProAlaSerLeuProTrp 121350 : ctgcattgcaggt.........................agCCAGCCAGTTTGCCCTGG : 124757 143 : SerProVal >>>> Target Intron 8 >>>> ArgArgSerAspValAlaTr : 152 ||| ! ! 54899 bp |||||||||! ! SerSerArg++ ++TyrPheSerAspValAspAs 124758 : AGCAGCAGAgt.........................agtatttttctgatGTGGATGA : 179686 153 : pAsn >>>> Target Intron 9 >>>> PheGluLys >>>> Target In : 157 ||| 5744 bp ||||||||| 44862 pAsn++ ++PheGluLys++ 179687 : TAATgt.........................agTTTGAGAAGgt.............. : 185447 158 : tron 10 >>>> PheLeu >>>> Target Intron 11 >>>> IleGlyPr : 161 bp |||||| 159358 bp ||| ! ++PheLeu++ ++IleLysCy 185448 : ............agTTTTTGgt..........................agATAAAATG : 389677 162 : oGluGlyGluProPhe{Ar} >>>> Target Intron 12 >>>> {g}ArgTy : 169 !:!!||| !||||||{||} 48979 bp {|} !|| sGlnGlyThrProPhe{Ar}-+ ++{g}PheTy 389678 : TCAGGGAACACCTTTC{AG}at..........................ag{A}TTTTA : 438680 170 : rSer{Ar} >>>> Target Intron 13 >>>> {g}ThrPheProThrIleAs : 177 ||||{||} 49964 bp {|} ||||||:::|||:: rSer{Ar}++ +-{g}ProPheProSerIleSe 438681 : TTCT{AG}gt..........................at{g}ccatttccttctatcaG : 488668 178 : nIleGluProAspIleLysArgLeuLeuLys : 187 !|||... !...|||:!!!.!||||||||| rIleSerAsnSerIleGlnHisLeuLeuLys 488669 : CATATCCAACTCAATACAACACCTACTCAAG : 488700 vulgar: SPP00000005_1.0 63 187 . NIVO01055543.1 1268 488700 + 100 M 8 24 S 0 1 5 0 2 I 0 5610 3 0 2 S 1 2 M 22 66 S 0 2 5 0 2 I 0 5828 3 0 2 S 1 1 M 7 21 S 0 1 5 0 2 I 0 8402 3 0 2 S 1 2 M 6 18 S 0 1 5 0 2 I 0 19605 3 0 2 S 1 2 M 1 3 S 0 2 5 0 2 I 0 49832 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 30572 3 0 2 S 1 2 M 15 45 5 0 2 I 0 3377 3 0 2 M 9 27 5 0 2 I 0 54895 3 0 2 M 8 24 5 0 2 I 0 5740 3 0 2 M 3 9 5 0 2 I 0 44858 3 0 2 M 2 6 5 0 2 I 0 159354 3 0 2 M 8 24 S 0 2 5 0 2 I 0 48975 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 49960 3 0 2 S 1 1 M 16 48 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 1269 488700 100 + . gene_id 13 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1269 1293 . + . NIVO01055543.1 exonerate:protein2genome:local exon 1269 1293 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1294 1295 . + . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1294 6907 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 6906 6907 . + . intron_id 0 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 6908 6977 . + . NIVO01055543.1 exonerate:protein2genome:local exon 6908 6977 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 6978 6979 . + . intron_id 2 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 6978 12809 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 12808 12809 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 12810 12832 . + . NIVO01055543.1 exonerate:protein2genome:local exon 12810 12832 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 12833 12834 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 12833 21238 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 21237 21238 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 21239 21259 . + . NIVO01055543.1 exonerate:protein2genome:local exon 21239 21259 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 21260 21261 . + . intron_id 4 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 21260 40868 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 40867 40868 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 40869 40875 . + . NIVO01055543.1 exonerate:protein2genome:local exon 40869 40875 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 40876 40877 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 40876 90711 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 90710 90711 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 90712 90737 . + . NIVO01055543.1 exonerate:protein2genome:local exon 90712 90737 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 90738 90739 . + . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 90738 121313 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 121312 121313 . + . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 121314 121360 . + . NIVO01055543.1 exonerate:protein2genome:local exon 121314 121360 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 121361 121362 . + . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 121361 124741 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 124740 124741 . + . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 124742 124768 . + . NIVO01055543.1 exonerate:protein2genome:local exon 124742 124768 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 124769 124770 . + . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 124769 179667 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 179666 179667 . + . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 179668 179691 . + . NIVO01055543.1 exonerate:protein2genome:local exon 179668 179691 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 179692 179693 . + . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 179692 185435 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 185434 185435 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 185436 185444 . + . NIVO01055543.1 exonerate:protein2genome:local exon 185436 185444 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 185445 185446 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 185445 230306 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 230305 230306 . + . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 230307 230312 . + . NIVO01055543.1 exonerate:protein2genome:local exon 230307 230312 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 230313 230314 . + . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 230313 389670 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 389669 389670 . + . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 389671 389696 . + . NIVO01055543.1 exonerate:protein2genome:local exon 389671 389696 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 389697 389698 . + . intron_id 12 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 389697 438675 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 438674 438675 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 438676 438687 . + . NIVO01055543.1 exonerate:protein2genome:local exon 438676 438687 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 438688 438689 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 438688 488651 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 488650 488651 . + . intron_id 12 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 488652 488700 . + . NIVO01055543.1 exonerate:protein2genome:local exon 488652 488700 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 1269 488700 100 + . alignment_id 13 ; Query SPP00000005_1.0 ; Align 1269 64 24 ; Align 6910 73 66 ; Align 12811 96 21 ; Align 21241 104 18 ; Align 40871 111 3 ; Align 90713 113 24 ; Align 121316 122 45 ; Align 124742 137 27 ; Align 179668 146 24 ; Align 185436 154 9 ; Align 230307 157 6 ; Align 389671 159 24 ; Align 438677 168 9 ; Align 488653 172 48 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence Model: protein2genome:local Raw score: 103 Query range: 40 -> 183 Target range: 18325 -> 872357 41 : GlyThrThrThrArgAspPheThrGlnLeuAsnGluLeuGlnCysArgPheProArgA : 60 |||.!!..!|||||| !||| !...:!!!..!!:||| ! ! ! ! !! !| GlyAlaValThrArgLeuPheTrpSerMetThrAspLeuAlaSerValValLeuLeuA 18326 : GGGGCGGTGACTCGTCTTTTCTGGAGTATGACAGACCTGGCCTCGGTGGTGCTTCTGA : 18383 61 : rgLeuValValLeu{G} >>>> Target Intron 1 >>>> {ly}PhePro{C : 68 ||:!! !!.!|||{|} 18391 bp {||} |||{ rgMetProAlaLeu{G}++ ++{ly}SerPro{G 18384 : GAATGCCTGCACTA{G}gt.........................ag{gc}tctcca{g : 36798 69 : } >>>> Target Intron 2 >>>> {ys}AsnGlnPhe >>>> Target I : 72 } 4070 bp {! }||||||!:! 5092 }++ ++{ly}AsnGlnTyr++ 36799 : }gt.........................ag{GA}AACCAGTATgt............. : 40882 73 : ntron 3 >>>> GlyHisGlnGlu{As} >>>> Target Intron 4 >>>> : 76 bp ||||||:!!.!.{!.} 76640 bp ++GlyHisLysAsn{Ar}++ + 40883 : ............agGGACACAAGAAC{AG}gt.........................a : 122624 77 : {n}CysGlnAsnGluGlu{I} >>>> Target Intron 5 >>>> {le}Leu : 83 {.}||||||||| !|||{:} 38842 bp {!!}||| +{g}CysGlnAsnTrpGlu{V}++ ++{al}Leu 122625 : g{G}TGTCAGAATTGGGAA{G}gt.........................ag{TA}CTT : 161487 84 : AsnSerLeuLysTyr >>>> Target Intron 6 >>>> ValArgProGlyGl : 93 !.!! !:!!|||||| 39493 bp :!!! !|||!.!|| ThrMetValLysTyr+- ++IleThrProAlaGl 161488 : ACTATGGTGAAATATgg.........................agATCACTCCGGCTGG : 201010 94 : yGly{T} >>>> Target Intron 7 >>>> {yr}GlnProThrPhe{T} > : 100 ||||{|} 15730 bp {||} ||| ...{.} yGly{T}++ ++{yr}LeuProIleLeu{V}++ 201011 : TGGC{T}gt.........................ag{at}ttgcctattcta{g}gt. : 216764 101 : >>> Target Intron 8 >>>> {hr}LeuValGlnLysCysGluValAsnGlyG : 110 78214 bp {.!}:::||| |||......:::....... ++{al}MetValProLysAlaHisLeuThrSerH 216765 : ........................ag{tg}atggttcctaaggcccacttgacttcac : 295005 111 : lnAsnGluHisProValPhe{Al} >>>> Target Intron 9 >>>> {a}Ty : 118 ..:::... { } 30037 bp {!}|| isSerArgMetSerGlySer{Ar}++ ++{g}Ty 295006 : attccaggatgtctggctct{ag}gt.........................ag{G}TA : 325066 119 : rLeuLys{A} >>>> Target Intron 10 >>>> {sp}LysLeuProTyrPr : 126 ||||!:!{!} 70551 bp { } |||||| || rLeuArg{G}++ ++{ly}AspLeuProAspPr 325067 : CCTCAGA{G}gt..........................ag{gg}gatcttcccgaccc : 395641 127 : oTyrAspAspProPheSerLeuMetThrAspProLysLeuIle{I} >>>> Targe : 141 | :::||| :::...:::|||...||| ||| {:} 1 oGlyIleGluPro---ThrPheLeuThrSerProAlaLeuAla{V}++ 395642 : agggatcgaaccc---acatttcttacatctcctgcattggca{g}gt.......... : 395686 142 : t Intron 11 >>>> {le}TrpSerProValArg >>>> Target Intron : 147 0317 bp {!!} ||| |||::: 96088 bp ++{al}CysSerSerValLys++ 395687 : ................ag{tt}tgctcatctgtaaaagt................... : 406020 148 : 12 >>>> ArgSer{As} >>>> Target Intron 13 >>>> {p}ValAla : 151 |||..!{..} 33013 bp {!} !!:!! ++ArgGlu{Se}++ ++{r}PheSer 406021 : .......agAGGGAA{AG}gt..........................ag{C}TTTTCA : 535131 152 : Trp >>>> Target Intron 14 >>>> AsnPheGluLysPheLeu >>>> : 159 ||| 88485 bp ||||||...:::|||::: Trp++ ++AsnPheArgGlnPheIle++ 535132 : TGGgt..........................agaattttcgacagtttattgt..... : 623642 160 : Target Intron 15 >>>> IleGlyProGluGlyGluProPheArgArgTyrSe : 170 70586 bp ::: |||...||| |||:::|| ++ValTrpArgLeuGlySerProArgSerArgTrpSe 623643 : .....................aggtctggaggctgggaagtccaagatcaaggtggtC : 694259 171 : rArgThr{P} >>>> Target Intron 16 >>>> {he}ProThrIleAsnIl : 178 | !!:!!{ } 178057 bp {! }||| !!:!!.!.:! rGlySer{V}++ ++{al}ProProLeuGlnVa 694260 : AGGATCT{G}gt..........................ag{tg}cCTCCTCTCCAAGT : 872340 179 : eGluProAspIleLys : 183 !:!! !!:!! !||| lLysAlaAsnAspLys 872341 : AAAGGCAAATGATAAA : 872357 vulgar: SPP00000005_1.0 40 183 . NIVO01055543.1 18325 872357 + 103 M 24 72 S 0 1 5 0 2 I 0 18387 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 4066 3 0 2 S 1 2 M 3 9 5 0 2 I 0 5088 3 0 2 M 4 12 S 0 2 5 0 2 I 0 76636 3 0 2 S 1 1 M 5 15 S 0 1 5 0 2 I 0 38838 3 0 2 S 1 2 M 6 18 5 0 2 I 0 39489 3 0 2 M 6 18 S 0 1 5 0 2 I 0 15726 3 0 2 S 1 2 M 4 12 S 0 1 5 0 2 I 0 78210 3 0 2 S 1 2 M 16 48 S 0 2 5 0 2 I 0 30033 3 0 2 S 1 1 M 3 9 S 0 1 5 0 2 I 0 70547 3 0 2 S 1 2 M 9 27 G 1 0 M 9 27 S 0 1 5 0 2 I 0 10313 3 0 2 S 1 2 M 5 15 5 0 2 I 0 96084 3 0 2 M 2 6 S 0 2 5 0 2 I 0 33009 3 0 2 S 1 1 M 3 9 5 0 2 I 0 88481 3 0 2 M 6 18 5 0 2 I 0 70582 3 0 2 M 14 42 S 0 1 5 0 2 I 0 178053 3 0 2 S 1 2 M 10 30 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 18326 872357 103 + . gene_id 14 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 18326 18398 . + . NIVO01055543.1 exonerate:protein2genome:local exon 18326 18398 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 18399 18400 . + . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 18399 36789 . + . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 36788 36789 . + . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 36790 36798 . + . NIVO01055543.1 exonerate:protein2genome:local exon 36790 36798 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 36799 36800 . + . intron_id 2 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 36799 40868 . + . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 40867 40868 . + . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 40869 40879 . + . NIVO01055543.1 exonerate:protein2genome:local exon 40869 40879 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 40880 40881 . + . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 40880 45971 . + . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 45970 45971 . + . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 45972 45985 . + . NIVO01055543.1 exonerate:protein2genome:local exon 45972 45985 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 45986 45987 . + . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 45986 122625 . + . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 122624 122625 . + . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 122626 122642 . + . NIVO01055543.1 exonerate:protein2genome:local exon 122626 122642 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 122643 122644 . + . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 122643 161484 . + . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 161483 161484 . + . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 161485 161504 . + . NIVO01055543.1 exonerate:protein2genome:local exon 161485 161504 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 161505 161506 . + . intron_id 6 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 161505 200997 . + . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 200996 200997 . + . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 200998 201016 . + . NIVO01055543.1 exonerate:protein2genome:local exon 200998 201016 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 201017 201018 . + . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 201017 216746 . + . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 216745 216746 . + . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 216747 216761 . + . NIVO01055543.1 exonerate:protein2genome:local exon 216747 216761 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 216762 216763 . + . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 216762 294975 . + . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 294974 294975 . + . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 294976 295027 . + . NIVO01055543.1 exonerate:protein2genome:local exon 294976 295027 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 295028 295029 . + . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 295028 325064 . + . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 325063 325064 . + . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 325065 325075 . + . NIVO01055543.1 exonerate:protein2genome:local exon 325065 325075 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 325076 325077 . + . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 325076 395626 . + . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 395625 395626 . + . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 395627 395683 . + . NIVO01055543.1 exonerate:protein2genome:local exon 395627 395683 . + . insertions 0 ; deletions 1 NIVO01055543.1 exonerate:protein2genome:local splice5 395684 395685 . + . intron_id 11 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 395684 406000 . + . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 405999 406000 . + . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 406001 406017 . + . NIVO01055543.1 exonerate:protein2genome:local exon 406001 406017 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 406018 406019 . + . intron_id 12 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 406018 502105 . + . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 502104 502105 . + . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 502106 502113 . + . NIVO01055543.1 exonerate:protein2genome:local exon 502106 502113 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 502114 502115 . + . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 502114 535126 . + . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 535125 535126 . + . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 535127 535136 . + . NIVO01055543.1 exonerate:protein2genome:local exon 535127 535136 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 535137 535138 . + . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 535137 623621 . + . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 623620 623621 . + . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 623622 623639 . + . NIVO01055543.1 exonerate:protein2genome:local exon 623622 623639 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 623640 623641 . + . intron_id 15 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 623640 694225 . + . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 694224 694225 . + . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 694226 694268 . + . NIVO01055543.1 exonerate:protein2genome:local exon 694226 694268 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 694269 694270 . + . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 694269 872325 . + . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 872324 872325 . + . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 872326 872357 . + . NIVO01055543.1 exonerate:protein2genome:local exon 872326 872357 . + . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 18326 872357 103 + . alignment_id 14 ; Query SPP00000005_1.0 ; Align 18326 41 72 ; Align 36792 66 6 ; Align 40871 69 9 ; Align 45972 72 12 ; Align 122627 77 15 ; Align 161487 83 18 ; Align 200998 89 18 ; Align 216749 96 12 ; Align 294978 101 48 ; Align 325066 118 9 ; Align 395629 122 27 ; Align 395656 132 27 ; Align 406003 142 15 ; Align 502106 147 6 ; Align 535128 150 9 ; Align 623622 153 18 ; Align 694226 159 42 ; Align 872328 174 30 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 982 Query range: 0 -> 190 Target range: 22496 -> 19447 1 : MetAlaPheIleAlaLysSerPheTyrAspLeuSerAlaIleSerLeuAspGlyGluLys : 20 ||||||!:!||||||||||||||||||||||||||||||||||||||||||||||||||| MetAlaTyrIleAlaLysSerPheTyrAspLeuSerAlaIleSerLeuAspGlyGluLys 22496 : ATGGCTTACATTGCCAAGTCCTTCTACGACCTCAGTGCTATCAGCCTGGATGGGGAGAAG : 22439 21 : ValAspPheAsnThrPheArgGlyArgAlaValLeuIleGluAsnValAlaSerLeuUnk : 40 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ValAspPheAsnThrPheArgGlyArgAlaValLeuIleGluAsnValAlaSerLeu*** 22438 : GTAGATTTCAATACATTCCGAGGCAGGGCAGTGCTGATTGAGAATGTGGCCTCGCTTTGA : 22379 41 : GlyThrThrThrArgAspPheThrGlnLeuAsnGluLeuGlnCysArgPheProArgArg : 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GlyThrThrThrArgAspPheThrGlnLeuAsnGluLeuGlnCysArgPheProArgArg 22378 : GGCACAACCACCCGGGACTTCACCCAACTCAACGAGCTGCAATGCCGCTTCCCCAGGCGC : 22319 61 : LeuValValLeuGlyPheProCysAsnGlnPheGlyHisGln >>>> Target Intr : 75 |||||||||||||||||||||||||||||||||||||||||| 2479 bp LeuValValLeuGlyPheProCysAsnGlnPheGlyHisGln++ 22318 : CTGGTGGTTCTTGGCTTCCCTTGCAATCAATTTGGACATCAGgt................ : 22272 76 : on 1 >>>> GluAsnCysGlnAsnGluGluIleLeuAsnSerLeuLysTyrValArgP : 91 ||||||||||||||||||||||||||||||||||||||||||||||||| ++GluAsnCysGlnAsnGluGluIleLeuAsnSerLeuLysTyrValArgP 22271 : .........agGAGAACTGTCAAAATGAAGAGATCTTGAATAGCCTCAAGTATGTCCGCC : 19747 92 : roGlyGlyGlyTyrGlnProThrPheThrLeuValGlnLysCysGluValAsnGlyGlnA : 111 |||||||||||!:!||||||||||||||||||||||||||||||!!:||||||||||||| roGlyGlyGlyPheGlnProThrPheThrLeuValGlnLysCysAspValAsnGlyGlnA 19746 : CTGGGGGTGGATTCCAGCCCACCTTCACCCTTGTCCAGAAGTGTGATGTGAATGGTCAGA : 19687 112 : snGluHisProValPheAlaTyrLeuLysAspLysLeuProTyrProTyrAspAspProP : 131 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| snGluHisProValPheAlaTyrLeuLysAspLysLeuProTyrProTyrAspAspProP 19686 : ATGAGCATCCTGTCTTCGCCTACCTGAAGGATAAGCTCCCCTACCCTTATGACGACCCGT : 19627 132 : heSerLeuMetThrAspProLysLeuIleIleTrpSerProValArgArgSerAspValA : 151 |||||||||||||||||||||||!!!|||||||||||||||||||||||||||||||||: heSerLeuMetThrAspProLysPheIleIleTrpSerProValArgArgSerAspValS 19626 : TTTCCCTCATGACCGATCCCAAGTTCATCATTTGGAGCCCCGTGCGCCGCTCGGATGTGT : 19567 152 : laTrpAsnPheGluLysPheLeuIleGlyProGluGlyGluProPheArgArgTyrSerA : 171 !!|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| erTrpAsnPheGluLysPheLeuIleGlyProGluGlyGluProPheArgArgTyrSerA 19566 : CCTGGAACTTTGAGAAGTTCCTCATTGGGCCGGAAGGGGAGCCCTTCCGCCGCTACAGCC : 19507 172 : rgThrPheProThrIleAsnIleGluProAspIleLysArgLeuLeuLysValAlaIle : 190 ||||||||! !|||||||||||||||||||||||||||||||||||||||||||||||| rgThrPheGlnThrIleAsnIleGluProAspIleLysArgLeuLeuLysValAlaIle 19506 : GCACCTTCCAAACCATTAACATCGAGCCTGACATCAAGCGCCTCCTCAAAGTTGCCATA : 19448 vulgar: SPP00000005_1.0 0 190 . NIVO01055543.1 22496 19447 - 982 M 74 222 5 0 2 I 0 2475 3 0 2 M 116 348 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 19448 22496 982 - . gene_id 1 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 22275 22496 . - . NIVO01055543.1 exonerate:protein2genome:local exon 22275 22496 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 22273 22274 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 19796 22274 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 19796 19797 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 19448 19795 . - . NIVO01055543.1 exonerate:protein2genome:local exon 19448 19795 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 19448 22496 982 - . alignment_id 1 ; Query SPP00000005_1.0 ; Align 22497 1 222 ; Align 19796 75 348 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 159 Query range: 3 -> 176 Target range: 1240074 -> 41339 4 : IleAlaLysSerPheTyrAspLeuSerAlaIleSerLeuAspGlyGlu{Ly} >> : 20 ||| !||| !|||||| !|||:!! ||||||||| !!|||{!:} IleIleLysLeuPheTyrIleArgSerSerGluSerLeuAspTrpGlu{Ar}++ 1240074 : ATCATTAAACTGTTCTACATAAGAAGTTCGGAGAGTTTGGATTGGGAG{AG}gt.. : 1240022 21 : >> Target Intron 1 >>>> {s}ValAspPheAsnThrPheArgGlyArgA : 30 99378 bp {!}:!! .!..!.||| !.!|||! ! ++{g}LeuMetIleGluThrLysAsnGlyMetM 1240021 : .......................ag{a}CTTATGATAGAAACAAAAAATGGCATGA : 1140618 31 : laValLeu{I} >>>> Target Intron 2 >>>> {le}GluAsnValAla : 37 !:!!|||{:} 73417 bp {!!}..!||| ! ! etLeuLeu{V}++ ++{al}ArgAsnCysArg 1140617 : TGCTTTTA{G}gt.........................ag{TC}AGAAACTGCAGA : 1067180 38 : SerLeuUnkGlyThrThrThrArgAspPheThrGlnLeu{As} >>>> Target : 51 ..!||| !! ! !! ! !! !|||:!! ! |||{!.} 29 AspLeuGluArgGlnArgIleTrpCysPheSerTyrLeu{Ar}++ 1067179 : GATCTGGAAAGGCAACGTATCTGGTGCTTTTCATATCTC{AG}gt........... : 1067134 52 : Intron 3 >>>> {n}GluLeuGlnCysArgPheProArgArg >>>> Tar : 61 811 bp {.}...||| |||..!|||||| !! ! ++{g}SerLeuPheCysGluPheProLeuMet++ 1067133 : ..............ag{A}AGTTTGTTTTGTGAGTTTCCATTGATGgt........ : 1037295 62 : get Intron 4 >>>> Leu >>>> Target Intron 5 >>>> ValVa : 63 157491 bp :!! 14102 bp ||| ++Val++ +-ValPh 1037294 : .................agGTAgt.........................aagtatt : 865698 64 : lLeuGlyPheProCysAsnGlnPheGlyHisGlnGluAsnCysGln >>>> Tar : 79 |||||||||||||||...... ||| :::... |||... eLeuGlyPheProCysGlySerAlaGlyLysGluSerAlaCysAsn++ 865697 : cttgggcttcccttgtggctcagctggtaaagaatctgcctgcaatgt........ : 865648 80 : get Intron 6 >>>> AsnGluGluIleLeuAsnSerLeuLysTyr >>>> : 89 95175 bp !..|||..!|||! ! !!!!||| ! ! ++ArgGluArgIleSerProArgLeuAlaGln+- 865647 : .................agAGGGAAAGAATATCTCCCAGGCTGGCACAGgg..... : 770443 90 : Target Intron 7 >>>> ValArgProGlyGly{G} >>>> Target In : 94 97487 bp :!!..!|||! !|||{|} 40078 ++MetGluProAspGly{G}++ 770442 : ....................agATGGAGCCTGATGGG{G}gt.............. : 672940 95 : tron 8 >>>> {ly}TyrGlnProThrPheThrLeuValGln >>>> Targe : 104 bp {||} :::||| ||| :::||| ++{ly}IleLysProLeuPheProAlaLeuGln++ 672939 : ...........ag{gg}atcaaacctttgtttcctgcattgcaggt.......... : 632833 105 : t Intron 9 >>>> LysCysGluValAsnGlyGln >>>> Target Intr : 111 323 bp ||||||..!! !::!! !||| 148870 ++LysCysSerGlySerAspGln++ 632832 : ...............agAAGTGTTCAGGATCTGACCAGgt................ : 632489 112 : on 10 >>>> Asn >>>> Target Intron 11 >>>> GluHisProVa : 115 bp !.. 60848 bp |||||| !|| ++Arg++ ++GluHisLysVa 632488 : ..........agAGGgt..........................agGAGCACAAAGT : 422761 116 : l{Ph} >>>> Target Intron 12 >>>> {e}AlaTyrLeu >>>> Ta : 120 |{!:} 67998 bp {:}:!!|||||| l{Tr}++ ++{p}SerTyrLeu++ 422760 : A{TG}gt..........................ag{G}TCTTATCTGgt....... : 354746 121 : rget Intron 13 >>>> >>>> Target Intron 14 >>>> >>> : 120 4806 bp 8309 bp ++++ ++++ 354745 : ...................aggt..........................aggt... : 341631 121 : > Target Intron 15 >>>> LysAspLysLeuProTyrProTyrAspAspP : 130 64671 bp :::||||||:::|||:::|||...| ++ProAlaArgLeuProHisProTrpAspSerP 341630 : .......................agcccgccaggctcccccatccctgggattctc : 276932 131 : ro{P} >>>> Target Intron 16 >>>> {he}Ser{Le} >>>> Tar : 133 ||{ } 79393 bp {!!}|||{:!} ro{V}+- ++{al}Ser{Me}++ 276931 : ca{g}gc..........................ag{tt}tca{aT}gt........ : 197526 134 : get Intron 17 >>>> {u}MetThrAspProLysLeuIleIleTrp{Se} : 143 29932 bp {!}:!:.!!.!. !!!.|||:!: !|||{.!} ++{t}LeuAlaGlnCysAsnLeuValTyrTrp{Gl}++ 197525 : ..................ag{G}TTAGCTCAGTGCAACCTCGTGTATTGG{GG}gt : 167566 144 : >>>> Target Intron 18 >>>> {r}ProValArgArgSerAspValAlaT : 152 43563 bp {!} !! !||||||..!!!:|||!.!| ++{y}AlaAsnArgArgGluGluValValT 167565 : ..........................ag{A}GCAAACAGAAGGGAGGAAGTAGTCT : 123978 153 : rp >>>> Target Intron 19 >>>> {As} >>>> Target Intron : 153 || 8229 bp {||} 22993 bp rp++ ++{As}++ 123977 : GGgt..........................ag{AA}gt.................. : 115742 154 : 20 >>>> {n}PheGluLysPheLeuIleGlyProGluGlyGluProPhe >> : 167 {|}|||..! ! !||||||||||||!!:||| ! +-{n}PheArgAlaGlnSerSerGlyProGluGlyAspProHis++ 115741 : ........at{c}ttcagAGCTCAGAGTTCAGGCCCTGAGGGGGATCCCCATgt.. : 92709 168 : >> Target Intron 21 >>>> ArgArgTyrSerArgThrPheProThrIle : 176 51342 bp ||| !! !.!!!.! !||||||!:!||| ++ArgAlaCysGlyHisLeuPheProSerIle 92708 : ........................agAGAGCCTGTGGACACCTTTTCCCCAGCATA : 41342 vulgar: SPP00000005_1.0 3 176 . NIVO01055543.1 1240074 41339 - 159 M 16 48 S 0 2 5 0 2 I 0 99374 3 0 2 S 1 1 M 12 36 S 0 1 5 0 2 I 0 73413 3 0 2 S 1 2 M 17 51 S 0 2 5 0 2 I 0 29807 3 0 2 S 1 1 M 9 27 5 0 2 I 0 157487 3 0 2 M 1 3 5 0 2 I 0 14098 3 0 2 M 17 51 5 0 2 I 0 95171 3 0 2 M 10 30 5 0 2 I 0 97483 3 0 2 M 5 15 S 0 1 5 0 2 I 0 40074 3 0 2 S 1 2 M 9 27 5 0 2 I 0 319 3 0 2 M 7 21 5 0 2 I 0 148866 3 0 2 M 1 3 5 0 2 I 0 60844 3 0 2 M 4 12 S 0 2 5 0 2 I 0 67994 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 64667 3 0 2 M 11 33 S 0 1 5 0 2 I 0 79389 3 0 2 S 1 2 M 1 3 S 0 2 5 0 2 I 0 29928 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 43559 3 0 2 S 1 1 M 9 27 5 0 2 I 0 8225 3 0 2 S 0 2 5 0 2 I 0 22989 3 0 2 S 1 1 M 13 39 5 0 2 I 0 51338 3 0 2 M 10 30 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 41340 1240074 159 - . gene_id 2 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1240025 1240074 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1240025 1240074 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1240023 1240024 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1140647 1240024 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1140647 1140648 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1140609 1140646 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1140609 1140646 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1140607 1140608 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1067192 1140608 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1067192 1067193 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1067137 1067191 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1067137 1067191 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1067135 1067136 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1037326 1067136 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1037326 1037327 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1037298 1037325 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1037298 1037325 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1037296 1037297 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 879807 1037297 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 879807 879808 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 879804 879806 . - . NIVO01055543.1 exonerate:protein2genome:local exon 879804 879806 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 879802 879803 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 865702 879803 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 865702 865703 . - . intron_id 4 ; splice_site "aa" NIVO01055543.1 exonerate:protein2genome:local cds 865651 865701 . - . NIVO01055543.1 exonerate:protein2genome:local exon 865651 865701 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 865649 865650 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 770476 865650 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 770476 770477 . - . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 770446 770475 . - . NIVO01055543.1 exonerate:protein2genome:local exon 770446 770475 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 770444 770445 . - . intron_id 7 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 672959 770445 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 672959 672960 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 672943 672958 . - . NIVO01055543.1 exonerate:protein2genome:local exon 672943 672958 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 672941 672942 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 632865 672942 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 632865 632866 . - . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 632836 632864 . - . NIVO01055543.1 exonerate:protein2genome:local exon 632836 632864 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 632834 632835 . - . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 632513 632835 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 632513 632514 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 632492 632512 . - . NIVO01055543.1 exonerate:protein2genome:local exon 632492 632512 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 632490 632491 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 483622 632491 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 483622 483623 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 483619 483621 . - . NIVO01055543.1 exonerate:protein2genome:local exon 483619 483621 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 483617 483618 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 422771 483618 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 422771 422772 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 422757 422770 . - . NIVO01055543.1 exonerate:protein2genome:local exon 422757 422770 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 422755 422756 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 422756 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 276963 341633 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 276963 276964 . - . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 276929 276962 . - . NIVO01055543.1 exonerate:protein2genome:local exon 276929 276962 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 276927 276928 . - . intron_id 16 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 197536 276928 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 197536 197537 . - . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 197529 197535 . - . NIVO01055543.1 exonerate:protein2genome:local exon 197529 197535 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 197527 197528 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 167597 197528 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 167597 167598 . - . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 167567 167596 . - . NIVO01055543.1 exonerate:protein2genome:local exon 167567 167596 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 167565 167566 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 124004 167566 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 124004 124005 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 123976 124003 . - . NIVO01055543.1 exonerate:protein2genome:local exon 123976 124003 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 123974 123975 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 115747 123975 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 115747 115748 . - . intron_id 18 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 115745 115746 . - . NIVO01055543.1 exonerate:protein2genome:local exon 115745 115746 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 115743 115744 . - . intron_id 20 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 92752 115744 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 92752 92753 . - . intron_id 19 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 92712 92751 . - . NIVO01055543.1 exonerate:protein2genome:local exon 92712 92751 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 92710 92711 . - . intron_id 21 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 41370 92711 . - . intron_id 21 NIVO01055543.1 exonerate:protein2genome:local splice3 41370 41371 . - . intron_id 20 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 41340 41369 . - . NIVO01055543.1 exonerate:protein2genome:local exon 41340 41369 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 41340 1240074 159 - . alignment_id 2 ; Query SPP00000005_1.0 ; Align 1240075 4 48 ; Align 1140646 21 36 ; Align 1067190 34 51 ; Align 1037325 52 27 ; Align 879807 61 3 ; Align 865702 62 51 ; Align 770476 79 30 ; Align 672959 89 15 ; Align 632863 95 27 ; Align 632513 104 21 ; Align 483622 111 3 ; Align 422771 112 12 ; Align 354758 117 9 ; Align 276963 120 33 ; Align 197534 132 3 ; Align 167596 134 27 ; Align 124003 144 27 ; Align 92751 154 39 ; Align 41370 167 30 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 131 Query range: 1 -> 154 Target range: 980189 -> 17826 2 : AlaPheIleAlaLysSerPheTyrAspLeuSerAlaIleSerLeuAspGlyGluLysV : 21 .!!.!!|||:!! ! |||||||||||||||||||||! !|||! !.....!..!...: ThrLeuIleSerHisSerPheTyrAspLeuSerAlaThrSerTyrSerSerSerSerL 980189 : ACTCTCATCTCTCACTCATTCTATGACCTTTCTGCCACTTCCTATTCATCATCATCTC : 980132 22 : alAspPheAsnThr >>>> Target Intron 1 >>>> PheArgGly{Ar} : 29 !!.!. !||| !! 75026 bp ||||||{||} euGlnAsnAsnPro++ ++GluArgGly{Ar}++ 980131 : TGCAGAATAATCCAgt.........................agGAGAGAGGA{AG}gt : 905080 30 : >>>> Target Intron 2 >>>> {g}AlaValLeu{I} >>>> Target In : 33 35181 bp {|} ||||||{:} 57012 +-{g}ProValLeu{V}++ 905079 : .........................at{a}cctgtctta{g}gt.............. : 869886 34 : tron 3 >>>> {le}GluAsnValAlaSerLeuUnkGlyThrThrThrArgAspPh : 47 bp {!!}|||!..:!! ! !|||...||| ! !!:!!:! ! ++{al}GluThrLeuTrpLeuLeuSerGlyGlnGlySerLysLeuSe 869885 : ...........ag{TT}GAGACACTGTGGCTTCTATCAGGTCAAGGGAGTAAACTCAG : 812835 48 : eThr{G} >>>> Target Intron 4 >>>> {ln}LeuAsnGluLeuGln > : 55 !|||{ } 56205 bp { !}:!!.!.:!!|||||| rThr{V}++ ++{al}IleGlnGlnLeuGln++ 812834 : TACA{G}gt.........................ag{TG}ATACAGCAGCTGCAGgt. : 756604 56 : >>> Target Intron 5 >>>> CysArgPheProArg{Ar} >>>> Target : 60 129761 bp ! ..!.!. !|||{||} 67 ++LeuGluMetAsnArg{Ar}++ 756603 : ........................agTTAGAGATGAACAGA{CG}gt........... : 626826 61 : Intron 6 >>>> {g}LeuValValLeuGlyPheProCysAsnGlnPheGlyHis : 73 640 bp {|}::::::... ...||| ... :::|||||| ++{g}IleLeuAlaTrpArgIleProTrpGlyProTrpGlyHis 626825 : ..............ag{t}attctggcctggagaattccatggggtccatggggtcac : 559151 74 : GlnGluAsnCysGlnAsnGluGluIleLeuAsnSerLeuLys{T} >>>> Target : 88 :::|||::: ......|||:::::: ...||||||...{ } 146 LysGluSerAspMetThrGluGlnLeuSerArgSerLeuSer{V}++ 559150 : aaagagtcggacatgactgagcaactttcacgttcactttct{g}gt........... : 559103 89 : Intron 7 >>>> {yr}Val{Ar} >>>> Target Intron 8 >>>> {g : 90 991 bp { }|||{||} 52266 bp {| ++{al}Val{Ar}++ ++{g 559102 : ..............ag{ta}gtc{ag}gt.........................ag{G : 359841 91 : }ProGlyGlyGlyTyrGln{Pr} >>>> Target Intron 9 >>>> {o}Thr : 98 }|||||||||.!!! !{||} 5062 bp {|}:!! }ProGlyGlySerLeuAla{Pr}-+ ++{o}Ser 359840 : }CCAGGAGGGAGTTTAGCG{CC}ct.........................ag{G}TCT : 354757 99 : PheThr >>>> Target Intron 10 >>>> >>>> Target Intron 1 : 101 !:! ! 4806 bp 8309 bp TyrLeu++ ++++ 354756 : TATCTGgt..........................aggt.................... : 349940 102 : 1 >>>> >>>> Target Intron 12 >>>> LeuVal >>>> Target : 103 5412 bp :::||| 618 ++++ ++ValVal++ 349939 : ......aggt..........................aggttgttgt............ : 336213 104 : Intron 13 >>>> GlnLysCysGluValAsnGly >>>> Target Intron : 110 73 bp ||| |||:!! ! ! ! 21649 bp ++GlnGlyCysLys***ProGln++ 336212 : ..............agCAAGGCTGCAAATAACCTCAGgt................... : 274319 111 : 14 >>>> GlnAsnGluHisProValPhe{A} >>>> Target Intron 15 > : 117 ::!....!. !|||! !|||{|} 15141 bp ++ArgGlyHisCysProGluPhe{A}++ 274318 : .......agagGGGACACTGTCCTGAATTT{G}gt....................... : 252648 118 : >>> {la}TyrLeuLysAspLysLeuProTyrProTyr{A} >>>> Target In : 128 {||} |||.....! !||||||! ! !! {|} 36014 ++{la}LeuLeuSerSerValLeuProLeuLeuSer{A}++ 252647 : ...ag{CT}CTGCTTTCCTCTGTGTTACCTTTACTCTCA{G}gt.............. : 237474 129 : tron 16 >>>> {sp}AspProPheSerLeu >>>> Target Intron 17 > : 134 bp {||}! !||||||..! ! 102181 bp ++{sp}AlaProPheGluLys+- 237473 : ............ag{AT}GCCCCTTTTGAGAAAga....................... : 201443 135 : >>> MetThrAspProLysLeuIleIleTrp{Se} >>>> Target Intron 1 : 143 |||:::|||:::|||:::::: {!!} 53909 bp ++AlaThrAsnProArgLeuLeuLeuGly{Ar}++ 201442 : ...aggcaacgaacccacgtcttctgcttggc{ag}gt.................... : 99233 144 : 8 >>>> {r}ProValArgArgSer{A} >>>> Target Intron 19 >>>> : 149 {!}||| !||||||.!!{!} 27466 bp ++{g}Pro***ArgArgGly{G}++ + 99232 : ......ag{A}CCCTGAAGAAGGGGA{G}gt..........................a : 17845 150 : {sp}ValAlaTrpAsnPhe : 154 {!:}||| !|||:!!||| +{lu}ValLysTrpAspPhe 17844 : g{AA}GTAAAATGGGACTTC : 17827 vulgar: SPP00000005_1.0 1 154 . NIVO01055543.1 980189 17826 - 131 M 24 72 5 0 2 I 0 75022 3 0 2 M 3 9 S 0 2 5 0 2 I 0 35177 3 0 2 S 1 1 M 3 9 S 0 1 5 0 2 I 0 57008 3 0 2 S 1 2 M 15 45 S 0 1 5 0 2 I 0 56201 3 0 2 S 1 2 M 5 15 5 0 2 I 0 129757 3 0 2 M 5 15 S 0 2 5 0 2 I 0 67636 3 0 2 S 1 1 M 27 81 S 0 1 5 0 2 I 0 146987 3 0 2 S 1 2 M 1 3 S 0 2 5 0 2 I 0 52262 3 0 2 S 1 1 M 6 18 S 0 2 5 0 2 I 0 5058 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 5408 3 0 2 M 2 6 5 0 2 I 0 61869 3 0 2 M 7 21 5 0 2 I 0 21645 3 0 2 M 7 21 S 0 1 5 0 2 I 0 15137 3 0 2 S 1 2 M 10 30 S 0 1 5 0 2 I 0 36010 3 0 2 S 1 2 M 5 15 5 0 2 I 0 102177 3 0 2 M 9 27 S 0 2 5 0 2 I 0 53905 3 0 2 S 1 1 M 5 15 S 0 1 5 0 2 I 0 27462 3 0 2 S 1 2 M 5 15 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 17827 980189 131 - . gene_id 3 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 980118 980189 . - . NIVO01055543.1 exonerate:protein2genome:local exon 980118 980189 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 980116 980117 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 905092 980117 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 905092 905093 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 905081 905091 . - . NIVO01055543.1 exonerate:protein2genome:local exon 905081 905091 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 905079 905080 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 869900 905080 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 869900 869901 . - . intron_id 1 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 869889 869899 . - . NIVO01055543.1 exonerate:protein2genome:local exon 869889 869899 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 869887 869888 . - . intron_id 3 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 812877 869888 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 812877 812878 . - . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 812829 812876 . - . NIVO01055543.1 exonerate:protein2genome:local exon 812829 812876 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 812827 812828 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 756624 812828 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 756624 756625 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 756607 756623 . - . NIVO01055543.1 exonerate:protein2genome:local exon 756607 756623 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 756605 756606 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 626846 756606 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 626846 626847 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 626829 626845 . - . NIVO01055543.1 exonerate:protein2genome:local exon 626829 626845 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 626827 626828 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 559189 626828 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 559189 559190 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 559106 559188 . - . NIVO01055543.1 exonerate:protein2genome:local exon 559106 559188 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 559104 559105 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 412115 559105 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 412115 412116 . - . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 412108 412114 . - . NIVO01055543.1 exonerate:protein2genome:local exon 412108 412114 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 412106 412107 . - . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 359842 412107 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 359842 359843 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 359821 359841 . - . NIVO01055543.1 exonerate:protein2genome:local exon 359821 359841 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 359819 359820 . - . intron_id 9 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 359820 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 336222 341633 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 336222 336223 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 336216 336221 . - . NIVO01055543.1 exonerate:protein2genome:local exon 336216 336221 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 336214 336215 . - . intron_id 13 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 274343 336215 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 274343 274344 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 274322 274342 . - . NIVO01055543.1 exonerate:protein2genome:local exon 274322 274342 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 274320 274321 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 252673 274321 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 252673 252674 . - . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 252651 252672 . - . NIVO01055543.1 exonerate:protein2genome:local exon 252651 252672 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 252649 252650 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 237510 252650 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 237510 237511 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 237477 237509 . - . NIVO01055543.1 exonerate:protein2genome:local exon 237477 237509 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 237475 237476 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 201463 237476 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 201463 201464 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 201446 201462 . - . NIVO01055543.1 exonerate:protein2genome:local exon 201446 201462 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 201444 201445 . - . intron_id 17 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 99265 201445 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 99265 99266 . - . intron_id 16 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 99236 99264 . - . NIVO01055543.1 exonerate:protein2genome:local exon 99236 99264 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 99234 99235 . - . intron_id 18 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 45327 99235 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 45327 45328 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 45310 45326 . - . NIVO01055543.1 exonerate:protein2genome:local exon 45310 45326 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 45308 45309 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 17844 45309 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 17844 17845 . - . intron_id 18 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 17827 17843 . - . NIVO01055543.1 exonerate:protein2genome:local exon 17827 17843 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 17827 980189 131 - . alignment_id 3 ; Query SPP00000005_1.0 ; Align 980190 2 72 ; Align 905092 26 9 ; Align 869899 30 9 ; Align 812875 34 45 ; Align 756622 50 15 ; Align 626846 55 15 ; Align 559188 61 81 ; Align 412113 89 3 ; Align 359841 91 18 ; Align 354758 98 9 ; Align 336222 101 6 ; Align 274343 103 21 ; Align 252673 110 21 ; Align 237508 118 30 ; Align 201461 129 15 ; Align 99265 134 27 ; Align 45326 144 15 ; Align 17842 150 15 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 119 Query range: 2 -> 180 Target range: 1193772 -> 75957 3 : PheIleAlaLysSerPheTyrAspLeuSerAlaIleSerLeuAsp{G} >>>> T : 18 .!.||| ...||||||::: ||||||||||||||| {|} IleIleProSerSerPhePhePheHisSerAlaIleSerLeuThr{G}+- 1193772 : ATAattccatcttcttttttttttcattcagccaTTTCTTTGACA{G}gg...... : 1193724 19 : arget Intron 1 >>>> {ly}GluLysVal{A} >>>> Target Intro : 22 46230 bp {||}|||!!.:!!{!} 43966 bp +-{ly}GluAsnIle{G}++ 1193723 : ...................at{ga}gaAAATATT{G}gt................. : 1147482 23 : n 2 >>>> {sp}PheAsnThrPheArgGlyArgAlaValLeuIleGlu >>>> : 35 { !}! !!:!..!.!!|||.!!||||||:!!||| ++{ly}SerTrpLeuTyrGluSerArgThrValLeuValGlu++ 1147481 : ........ag{GC}TCATGGTTGTATGAGAGCAGGACTGTGTTGGTTGAAgt.... : 1103478 36 : Target Intron 3 >>>> AsnValAlaSerLeuUnkGlyThr{Th} >>> : 43 54967 bp |||||||||! ! ! |||..!{ } ++AsnValAlaLeuAsnLeuGlyVal{Ph}++ 1103477 : .....................agAATGTTGCTTTAAACCTAGGAGTC{TT}gt... : 1048485 44 : > Target Intron 4 >>>> {r}ThrArgAspPheThrGlnLeuAsnGluLe : 53 60533 bp {!}! ! !..!||||||:!!:!! !:!!|| ++{e}ArgAlaSerPheThrGluIlePheGlnLe 1048484 : ......................ag{t}AGGGCATCCTTTACTGAGATTTTTCAGCT : 987926 54 : uGlnCysArgPhePro >>>> Target Intron 5 >>>> ArgArg >>> : 61 | !!!.||| 145410 bp !:!!:! uIleValValLeuPro++ ++LysLys++ 987925 : AATTGTAGTTTTACCTgt.........................agAAGAAGgt... : 842490 62 : > Target Intron 6 >>>> Leu{V} >>>> Target Intron 7 >>> : 62 27722 bp |||{:} 53606 bp ++Leu{L}++ 842489 : ......................agcta{t}gt........................ : 814764 63 : > {al}ValLeuGlyPheProCysAsnGlnPhe{G} >>>> Target Intro : 72 {!!}:::|||...|||||||||...... {!} 87766 bp ++{eu}LeuLeuSerPheProCysGlySerThr{A}++ 814763 : .ag{ta}ctcttgagtttcccttgtggctcaact{g}gt................. : 761128 73 : n 8 >>>> {ly}HisGlnGluAsnCys{G} >>>> Target Intron 9 > : 78 {.!}|||..!|||::! { } 175220 bp ++{la}HisMetGluSerThr{G}++ 761127 : ........ag{CA}CATATGGAGTCCACA{G}gt...................... : 673344 79 : >>> {ln}AsnGluGluIleLeuAsnSerLeuLysTyrValArgProGlyGlyGl : 94 { !}|||! !.!!! !..!|||!!!!.. !:!!!.!|||||| ! ++{ly}AsnValProPheCysGlySerPheSerSerLeuAsnProGlyMetLy 673343 : ...ag{ga}AATGTTCCATTTTGTGGCAGCTTCAGCAGTCTGAATCCTGGAATGAA : 498079 95 : yTyrGlnPro >>>> Target Intron 10 >>>> ThrPheThrLeuValG : 103 ! ||| ! 52335 bp :!! ! ||||||! !. sMetGlnGlu-+ ++SerValThrLeuGlyS 498078 : GATGCAAGAGct..........................agTCTGTGACACTAGGGA : 445717 104 : lnLysCysGluValAsnGlyGln >>>> Target Intron 11 >>>> Asn : 111 ..:!!! !! !!!.|||||| 3563 bp ..! erGluLeuLeuGluLysGlyGln++ +-Gly 445716 : GCGAGTTGCTGGAGAAAGGGCAGgt..........................aaGGC : 442130 112 : GluHisProValPheAlaTyrLeuLysAspLys{Le} >>>> Target Intro : 123 ! ...|||:!!||||||||||||||| ! ! { } 42128 bp ValArgProIlePheAlaTyrLeuLysThrTyr{Ar}+- 442129 : GTTAGGCCTATCTTTGCTTATCTGAAAACTTAC{AG}gc................. : 442090 124 : n 12 >>>> {u}ProTyrProTyrAspAspPro{Ph} >>>> Target Int : 131 {!}||| !!|||!:!..!||| !{ } 45182 -+{g}ProAspProPheSerAspGlu{Ar}+- 442089 : .........tg{G}CCTGACCCTTTCTCTGATGAA{AG}gc............... : 399938 132 : ron 13 >>>> {e}SerLeuMet >>>> Target Intron 14 >>>> : 135 bp { }|||! !:!! 4806 bp ++{g}SerTyrLeu++ +++ 399937 : ...........ag{G}TCTTATCTGgt..........................agg : 349942 136 : >>>> Target Intron 15 >>>> >>>> Target Intron 16 >>> : 135 8309 bp 29956 bp + ++++ 349941 : t..........................aggt......................... : 341631 136 : > ThrAspPro{L} >>>> Target Intron 17 >>>> {ys}LeuIleI : 141 |||||||||{:} 144461 bp {!!}||| !. ++ThrAspPro{G}++ ++{lu}LeuProP 341630 : .agACAGATCCA{G}gt..........................ag{AA}CTACCTT : 167198 142 : leTrpSerProValArg >>>> Target Intron 18 >>>> ArgSerAsp : 149 !!|||..!||||||!:! 55891 bp |||||| ! heTrpGlnProValLys+- ++ArgSer*** 167197 : TCTGGCAGCCTGTGAAGgg..........................agAGATCATAA : 111283 150 : ValAlaTrpAsnPheGluLysPheLeu{Il} >>>> Target Intron 19 > : 159 ! !|||||||||... ! ! :!!{ } 2662 bp Asn***TrpAsnPheSer***ValMet{Gl}++ 111282 : AACTAGTGGAATTTTTCCTGAGTAATG{GG}gt....................... : 111249 160 : >>> {e}GlyProGluGlyGluProPheArg{A} >>>> Target Intron : 168 { }||||||... :::|||::: {.} 3329 bp ++{y}GlyProArgPheLysProTrpSer{G}+- 111248 : ...ag{g}gggccaaggttcaaaccctggtca{g}gg................... : 108561 169 : 20 >>>> {rg}TyrSer{A} >>>> Target Intron 21 >>>> {rg} : 171 {.!}|||..!{|} 29239 bp {||} ++{lu}TyrGln{A}++ ++{rg} 108560 : .......ag{AA}TACCAA{A}gt..........................ag{ga} : 75986 172 : ThrPheProThrIleAsnIleGluPro : 180 ...||| ...:::|||||| AspLeuProAspProGlyValGluPro 75985 : gatcttcccgatccaggggtggaaccc : 75958 vulgar: SPP00000005_1.0 2 180 . NIVO01055543.1 1193772 75957 - 119 M 15 45 S 0 1 5 0 2 I 0 46226 3 0 2 S 1 2 M 3 9 S 0 1 5 0 2 I 0 43962 3 0 2 S 1 2 M 12 36 5 0 2 I 0 54963 3 0 2 M 8 24 S 0 2 5 0 2 I 0 60529 3 0 2 S 1 1 M 15 45 5 0 2 I 0 145406 3 0 2 M 2 6 5 0 2 I 0 27718 3 0 2 M 1 3 S 0 1 5 0 2 I 0 53602 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 87762 3 0 2 S 1 2 M 5 15 S 0 1 5 0 2 I 0 175216 3 0 2 S 1 2 M 19 57 5 0 2 I 0 52331 3 0 2 M 13 39 5 0 2 I 0 3559 3 0 2 M 12 36 S 0 2 5 0 2 I 0 42124 3 0 2 S 1 1 M 7 21 S 0 2 5 0 2 I 0 45178 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 29952 3 0 2 M 3 9 S 0 1 5 0 2 I 0 144457 3 0 2 S 1 2 M 8 24 5 0 2 I 0 55887 3 0 2 M 12 36 S 0 2 5 0 2 I 0 2658 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 3325 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 29235 3 0 2 S 1 2 M 9 27 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 75958 1193772 119 - . gene_id 4 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1193727 1193772 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1193727 1193772 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1193725 1193726 . - . intron_id 1 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 1147497 1193726 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1147497 1147498 . - . intron_id 0 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 1147485 1147496 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1147485 1147496 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1147483 1147484 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1103519 1147484 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1103519 1103520 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1103481 1103518 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1103481 1103518 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1103479 1103480 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1048514 1103480 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1048514 1048515 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1048488 1048513 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1048488 1048513 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1048486 1048487 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 987955 1048487 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 987955 987956 . - . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 987909 987954 . - . NIVO01055543.1 exonerate:protein2genome:local exon 987909 987954 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 987907 987908 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 842499 987908 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 842499 842500 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 842493 842498 . - . NIVO01055543.1 exonerate:protein2genome:local exon 842493 842498 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 842491 842492 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 814771 842492 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 814771 814772 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 814767 814770 . - . NIVO01055543.1 exonerate:protein2genome:local exon 814767 814770 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 814765 814766 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 761161 814766 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 761161 761162 . - . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 761131 761160 . - . NIVO01055543.1 exonerate:protein2genome:local exon 761131 761160 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 761129 761130 . - . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 673365 761130 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 673365 673366 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 673347 673364 . - . NIVO01055543.1 exonerate:protein2genome:local exon 673347 673364 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 673345 673346 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 498127 673346 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 498127 498128 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 498068 498126 . - . NIVO01055543.1 exonerate:protein2genome:local exon 498068 498126 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 498066 498067 . - . intron_id 10 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 445733 498067 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 445733 445734 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 445694 445732 . - . NIVO01055543.1 exonerate:protein2genome:local exon 445694 445732 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 445692 445693 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 442131 445693 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 442131 442132 . - . intron_id 10 ; splice_site "AA" NIVO01055543.1 exonerate:protein2genome:local cds 442093 442130 . - . NIVO01055543.1 exonerate:protein2genome:local exon 442093 442130 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 442091 442092 . - . intron_id 12 ; splice_site "GC" NIVO01055543.1 exonerate:protein2genome:local intron 399965 442092 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 399965 399966 . - . intron_id 11 ; splice_site "TG" NIVO01055543.1 exonerate:protein2genome:local cds 399941 399964 . - . NIVO01055543.1 exonerate:protein2genome:local exon 399941 399964 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 399939 399940 . - . intron_id 13 ; splice_site "GC" NIVO01055543.1 exonerate:protein2genome:local intron 354759 399940 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 311678 341633 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 311678 311679 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 311668 311677 . - . NIVO01055543.1 exonerate:protein2genome:local exon 311668 311677 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 311666 311667 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 167207 311667 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 167207 167208 . - . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 167181 167206 . - . NIVO01055543.1 exonerate:protein2genome:local exon 167181 167206 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 167179 167180 . - . intron_id 18 ; splice_site "GG" NIVO01055543.1 exonerate:protein2genome:local intron 111290 167180 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 111290 111291 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 111252 111289 . - . NIVO01055543.1 exonerate:protein2genome:local exon 111252 111289 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 111250 111251 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 108590 111251 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 108590 108591 . - . intron_id 18 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 108564 108589 . - . NIVO01055543.1 exonerate:protein2genome:local exon 108564 108589 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 108562 108563 . - . intron_id 20 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 105235 108563 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 105235 105236 . - . intron_id 19 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 105226 105234 . - . NIVO01055543.1 exonerate:protein2genome:local exon 105226 105234 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 105224 105225 . - . intron_id 21 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 75987 105225 . - . intron_id 21 NIVO01055543.1 exonerate:protein2genome:local splice3 75987 75988 . - . intron_id 20 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 75958 75986 . - . NIVO01055543.1 exonerate:protein2genome:local exon 75958 75986 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 75958 1193772 119 - . alignment_id 4 ; Query SPP00000005_1.0 ; Align 1193773 3 45 ; Align 1147495 19 9 ; Align 1103517 23 36 ; Align 1048514 35 24 ; Align 987954 44 45 ; Align 842499 59 6 ; Align 814771 61 3 ; Align 761159 63 27 ; Align 673363 73 15 ; Align 498125 79 57 ; Align 445733 98 39 ; Align 442131 111 36 ; Align 399964 124 21 ; Align 354758 132 9 ; Align 311678 135 9 ; Align 167205 139 24 ; Align 111290 147 36 ; Align 108589 160 24 ; Align 105233 169 6 ; Align 75985 172 27 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 130 Query range: 1 -> 190 Target range: 1216630 -> 252504 2 : AlaPheIleAlaLysSerPheTyrAspLeuSerAlaIle >>>> Target Int : 15 !.!!!.:!! !...||| |||..!:!!||| !:!: 6614 b ValLeuLeuLeuSerSerThrTyrSerIleSerPheLeu++ 1216630 : GTTTTGTTATTGTCCTCCACATACAGCATTTCATTTCTGgt............... : 1216589 16 : ron 1 >>>> SerLeuAspGlyGluLysValAspPheAsn >>>> Target : 25 p |||::::::... |||||| ... 1553 ++SerMetGluSer***ProValAspHisGln++ 1216588 : ..........agagcatggagtcttagccagtggaccaccaggt............ : 1209945 26 : Intron 2 >>>> ThrPheArgGlyArgAla{Va} >>>> Target Intro : 31 58 bp !:!|||!!!||||||:!!{ } 24326 bp ++SerPheSerGlyArgSer{Ly}++ 1209944 : .............agAGTTTTAGTGGAAGATCC{AA}gt................. : 1054567 32 : n 3 >>>> {l}LeuIleGluAsn >>>> Target Intron 4 >>>> Va : 36 {!}:!!||||||!!. 47659 bp || ++{s}MetIleGluLys++ ++Va 1054566 : ........ag{G}ATGATAGAAAAAgt.........................agGT : 982571 37 : lAlaSerLeuUnkGlyThrThrThr{Ar} >>>> Target Intron 5 >>>> : 45 | ! !! !...|||.!! !|||{||} 15860 bp lLeuArgAlaSerGlyAla***Thr{Ar}+- 982570 : GCTGCGTGCATCTGGTGCCTGAACA{AG}ga......................... : 982540 46 : {g}AspPheThrGlnLeuAsnGluLeuGlnCysArgPhe{Pr} >>>> Targ : 58 {|}||| |||...:::::: :::...||| { } ++{g}Asp***ThrSerIleSerCysIleSerCysLeuGly{Se}++ 982539 : ag{g}gattgaaccagcatctcttgcatctcctgccttggc{ag}gt......... : 966641 59 : et Intron 6 >>>> {o}Arg{Ar} >>>> Target Intron 7 >>>> : 60 16709 bp {!}..!{||} 15411 bp ++{r}Glu{Ar}++ + 966640 : ................ag{T}GAG{AG}gt.........................a : 934519 61 : {g}Leu{Va} >>>> Target Intron 8 >>>> {l}ValLeuGlyPheP : 67 {|}:::{ } 23000 bp {!}:!!:!!|||:::| +{g}Ile{Gl}++ ++{n}MetValGlyTyrP 934518 : g{a}ata{cA}gt.........................ag{A}ATGGTGGGctacc : 911498 68 : roCysAsnGlnPhe{G} >>>> Target Intron 9 >>>> {ly}HisGln : 74 |||||...... {|} 12094 bp {||}||| ! roCysGlySerThr{G}++ +-{ly}HisLeu 911497 : cttgtggctcaact{g}gt.........................aa{GT}CACTTA : 899383 75 : GluAsnCysGlnAsn{G} >>>> Target Intron 10 >>>> {lu}Glu{ : 82 ||||||!!.{|} 56866 bp {||}|||{ ThrLeuCysGlnLys{G}++ ++{lu}Glu{ 899382 : ACTCTGTGCCAAAAA{G}gt..........................ag{AA}GAA{ : 842493 83 : I} >>>> Target Intron 11 >>>> {le}LeuAsnSerLeuLysTyrVa : 89 :} 1519 bp {!!}:!!:::|||||| !! ! :! V}++ ++{al}IleSerSerLeu***LysIl 842492 : G}gt..........................ag{TT}ATTTCATCTCTTTAGAAAAT : 840953 90 : lArgPro{Gl} >>>> Target Intron 12 >>>> {y}GlyGlyTyrGln : 96 !! ! !{||} 26808 bp {|}|||... ||| eIleVal{Gl}++ ++{y}GlySerCysGln 840952 : AATAGTA{GG}gt..........................ag{g}ggatcttgccag : 814124 97 : Pro{T} >>>> Target Intron 13 >>>> {hr}PheThrLeuValGlnL : 104 |||{ } 46527 bp { !}! ..!|||!.!... Pro{G}+- ++{ly}***ValLeuAlaSerA 814123 : cca{g}gg..........................ag{GC}TAGGTATTAGCATCTG : 767573 105 : ysCysGluValAsnGlyGlnAsnGluHisProValPhe{A} >>>> Target I : 117 ! |||:!!|||:!!||| !! !||| ! ! ! {!} 1147 spCysGlnValHisGly***ValGluGlySer***Val{V}++ 767572 : ACTGCCAAGTTCATGGGTAGGTTGAAGGGAGTTGAGTG{G}gt............. : 767531 118 : ntron 14 >>>> {la}TyrLeuLysAsp{Ly} >>>> Target Intron : 122 2 bp {.!}|||||||||.!.{||} 19476 bp +-{al}TyrLeuLysGln{Ly}++ 767530 : .............ac{TT}TACCTCAAGCAG{AA}gt................... : 756043 123 : 15 >>>> {s}LeuProTyrProTyrAspAspPro{P} >>>> Target Int : 131 {|}||||||:::|||:::|||...|||{.} 53951 ++{s}LeuProPheProTrpAspSerPro{I}-+ 756042 : .......ag{g}ctcccctttccatgggattctcca{a}at............... : 736541 132 : ron 16 >>>> {he}SerLeuMetThrAsp >>>> Target Intron 17 : 137 bp {!!}|||||| ||| 2548 bp ++{le}SerLeuThrLeuAsp++ 736540 : ...........ag{tt}tctcttaccttggacgt...................... : 682573 138 : >>>> ProLysLeu >>>> Target Intron 18 >>>> IleIleTrpSe : 143 ! !||| 6654 bp !|||||||| ++MetLeuLeu++ ++HisIleTrpSe 682572 : ....agATGTTGCTGgt..........................agCACATATGGAG : 673355 144 : rProVal >>>> Target Intron 19 >>>> ArgArgSerAspVal{A} : 151 |||| ! 41417 bp ...!.!.!!! !:!!{|} rProGln++ ++AsnHisGlyGlyIle{A}+ 673354 : TCCACAGgt..........................agaacCATGGTGGCATA{G}g : 631913 152 : >>>> Target Intron 20 >>>> {la}TrpAsnPheGluLysPheLeu{I : 159 100546 bp {||} ||| ...||||||{: + ++{la}GlyCysPheLeuSerPheLeu{L 631912 : t..........................ag{ca}ggttgctttctttcatttcta{t : 531344 160 : l} >>>> Target Intron 21 >>>> {e}GlyProGluGlyGluProPhe : 166 !} 63830 bp {:}||||||! !! ! ! e}++ ++{u}GlyProGlyThrAlaCysPro 531343 : t}gt..........................ag{G}GGCCCAGGCACTGCATGTCCA : 467493 167 : {Ar} >>>> Target Intron 22 >>>> {g}ArgTyrSer >>>> Tar : 171 {||} 112730 bp {|} !||| ! {Ar}++ ++{g}SerTyrLeu++ 467492 : {AG}gt..........................ag{G}TCTTATCTGgt........ : 354746 172 : get Intron 23 >>>> >>>> Target Intron 24 >>>> >>>> : 171 4806 bp 8309 bp ++++ ++++ 354745 : ..................aggt..........................aggt.... : 341631 172 : Target Intron 25 >>>> ArgThrPheProThrIleAsnIleGluPro{A : 181 51102 bp ||| ||||||||| ... ...|||{| ++ArgIlePheProThrGlnGlySerAsnPro{A 341630 : ......................agaggatcttcccaacccagggatcaaaccca{g : 290501 182 : } >>>> Target Intron 26 >>>> {sp}IleLysArgLeuLeuLysVal : 188 } 37967 bp {||} ||| !||||||||| }++ ++{sp}ArgLysThrGluLeuLysVal 290500 : }gt..........................ag{at}aggaaaacagAACTCAAAGTC : 252513 189 : AlaIle : 190 !:!! GlnLeu 252512 : CAACTT : 252505 vulgar: SPP00000005_1.0 1 190 . NIVO01055543.1 1216630 252504 - 130 M 13 39 5 0 2 I 0 6610 3 0 2 M 10 30 5 0 2 I 0 155354 3 0 2 M 6 18 S 0 2 5 0 2 I 0 24322 3 0 2 S 1 1 M 4 12 5 0 2 I 0 47655 3 0 2 M 9 27 S 0 2 5 0 2 I 0 15856 3 0 2 S 1 1 M 12 36 S 0 2 5 0 2 I 0 16705 3 0 2 S 1 1 M 1 3 S 0 2 5 0 2 I 0 15407 3 0 2 S 1 1 M 1 3 S 0 2 5 0 2 I 0 22996 3 0 2 S 1 1 M 9 27 S 0 1 5 0 2 I 0 12090 3 0 2 S 1 2 M 7 21 S 0 1 5 0 2 I 0 56862 3 0 2 S 1 2 M 1 3 S 0 1 5 0 2 I 0 1515 3 0 2 S 1 2 M 9 27 S 0 2 5 0 2 I 0 26804 3 0 2 S 1 1 M 5 15 S 0 1 5 0 2 I 0 46523 3 0 2 S 1 2 M 18 54 S 0 1 5 0 2 I 0 11468 3 0 2 S 1 2 M 4 12 S 0 2 5 0 2 I 0 19472 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 53947 3 0 2 S 1 2 M 5 15 5 0 2 I 0 2544 3 0 2 M 3 9 5 0 2 I 0 6650 3 0 2 M 6 18 5 0 2 I 0 41413 3 0 2 M 5 15 S 0 1 5 0 2 I 0 100542 3 0 2 S 1 2 M 7 21 S 0 2 5 0 2 I 0 63826 3 0 2 S 1 1 M 7 21 S 0 2 5 0 2 I 0 112726 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 51098 3 0 2 M 10 30 S 0 1 5 0 2 I 0 37963 3 0 2 S 1 2 M 9 27 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 252505 1216630 130 - . gene_id 5 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1216592 1216630 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1216592 1216630 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1216590 1216591 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1209978 1216591 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1209978 1209979 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1209948 1209977 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1209948 1209977 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1209946 1209947 . - . intron_id 2 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1054590 1209947 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1054590 1054591 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1054570 1054589 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1054570 1054589 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1054568 1054569 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1030244 1054569 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1030244 1030245 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1030231 1030243 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1030231 1030243 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1030229 1030230 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 982572 1030230 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 982572 982573 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 982543 982571 . - . NIVO01055543.1 exonerate:protein2genome:local exon 982543 982571 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 982541 982542 . - . intron_id 5 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 966683 982542 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 966683 966684 . - . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 966644 966682 . - . NIVO01055543.1 exonerate:protein2genome:local exon 966644 966682 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 966642 966643 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 949935 966643 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 949935 949936 . - . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 949929 949934 . - . NIVO01055543.1 exonerate:protein2genome:local exon 949929 949934 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 949927 949928 . - . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 934518 949928 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 934518 934519 . - . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 934512 934517 . - . NIVO01055543.1 exonerate:protein2genome:local exon 934512 934517 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 934510 934511 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 911512 934511 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 911512 911513 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 911483 911511 . - . NIVO01055543.1 exonerate:protein2genome:local exon 911483 911511 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 911481 911482 . - . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 899389 911482 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 899389 899390 . - . intron_id 8 ; splice_site "AA" NIVO01055543.1 exonerate:protein2genome:local cds 899365 899388 . - . NIVO01055543.1 exonerate:protein2genome:local exon 899365 899388 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 899363 899364 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 842499 899364 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 842499 842500 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 842493 842498 . - . NIVO01055543.1 exonerate:protein2genome:local exon 842493 842498 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 842491 842492 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 840974 842492 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 840974 840975 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 840943 840973 . - . NIVO01055543.1 exonerate:protein2genome:local exon 840943 840973 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 840941 840942 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 814135 840942 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 814135 814136 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 814118 814134 . - . NIVO01055543.1 exonerate:protein2genome:local exon 814118 814134 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 814116 814117 . - . intron_id 13 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 767591 814117 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 767591 767592 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 767534 767590 . - . NIVO01055543.1 exonerate:protein2genome:local exon 767534 767590 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 767532 767533 . - . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 756062 767533 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 756062 756063 . - . intron_id 13 ; splice_site "aC" NIVO01055543.1 exonerate:protein2genome:local cds 756046 756061 . - . NIVO01055543.1 exonerate:protein2genome:local exon 756046 756061 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 756044 756045 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 736570 756045 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 736570 736571 . - . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 736544 736569 . - . NIVO01055543.1 exonerate:protein2genome:local exon 736544 736569 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 736542 736543 . - . intron_id 16 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local intron 682593 736543 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 682593 682594 . - . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 682576 682592 . - . NIVO01055543.1 exonerate:protein2genome:local exon 682576 682592 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 682574 682575 . - . intron_id 17 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 680028 682575 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 680028 680029 . - . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 680019 680027 . - . NIVO01055543.1 exonerate:protein2genome:local exon 680019 680027 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 680017 680018 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 673365 680018 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 673365 673366 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 673347 673364 . - . NIVO01055543.1 exonerate:protein2genome:local exon 673347 673364 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 673345 673346 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 631930 673346 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 631930 631931 . - . intron_id 18 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 631914 631929 . - . NIVO01055543.1 exonerate:protein2genome:local exon 631914 631929 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 631912 631913 . - . intron_id 20 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 531368 631913 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 531368 531369 . - . intron_id 19 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 531343 531367 . - . NIVO01055543.1 exonerate:protein2genome:local exon 531343 531367 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 531341 531342 . - . intron_id 21 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 467513 531342 . - . intron_id 21 NIVO01055543.1 exonerate:protein2genome:local splice3 467513 467514 . - . intron_id 20 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 467489 467512 . - . NIVO01055543.1 exonerate:protein2genome:local exon 467489 467512 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 467487 467488 . - . intron_id 22 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 467488 . - . intron_id 22 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 21 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 23 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 23 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 22 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 24 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 24 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 23 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 25 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 290532 341633 . - . intron_id 25 NIVO01055543.1 exonerate:protein2genome:local splice3 290532 290533 . - . intron_id 24 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 290501 290531 . - . NIVO01055543.1 exonerate:protein2genome:local exon 290501 290531 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 290499 290500 . - . intron_id 26 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 252534 290500 . - . intron_id 26 NIVO01055543.1 exonerate:protein2genome:local splice3 252534 252535 . - . intron_id 25 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 252505 252533 . - . NIVO01055543.1 exonerate:protein2genome:local exon 252505 252533 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 252505 1216630 130 - . alignment_id 5 ; Query SPP00000005_1.0 ; Align 1216631 2 39 ; Align 1209978 15 30 ; Align 1054590 25 18 ; Align 1030243 32 12 ; Align 982572 36 27 ; Align 966682 46 36 ; Align 949934 59 3 ; Align 934517 61 3 ; Align 911511 63 27 ; Align 899387 73 21 ; Align 842497 81 3 ; Align 840972 83 27 ; Align 814134 93 15 ; Align 767589 99 54 ; Align 756060 118 12 ; Align 736569 123 24 ; Align 682591 132 15 ; Align 680028 137 9 ; Align 673365 140 18 ; Align 631930 146 15 ; Align 531366 152 21 ; Align 467512 160 21 ; Align 354758 168 9 ; Align 290532 171 30 ; Align 252532 182 27 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 118 Query range: 9 -> 186 Target range: 1196025 -> 111797 10 : AspLeuSerAlaIleSerLeuAspGlyGlu{Ly} >>>> Target Intron 1 : 20 !!::!!! !||||||:!!!!! ||||||{||} 61967 bp GluIleLeuAlaIleAlaPheArgGlyGlu{Ly}++ 1196025 : GAAATTTTGGCAATCGCCTTCAGAGGAGAA{Aa}gt.................... : 1195991 21 : >>>> {s}ValAspPheAsnThrPheArgGly{Ar} >>>> Target Intr : 29 {|}:!!||| ! |||.!.! ! !{||} 55042 b ++{s}LeuAspThrLeuThrLeuThrPro{Ar}++ 1195990 : .....ag{G}CTGGACACCCTGACACTGACTCCT{AG}gt................ : 1133997 30 : on 2 >>>> {g}Ala >>>> Target Intron 3 >>>> ValLeuIleG : 34 p {|} ! 81808 bp :!!:!!.!!| ++{g}Arg++ ++IleValPheG 1133996 : .........ag{A}AGGgt.........................agATTGTTTTTG : 997136 35 : luAsnValAlaSer{Le} >>>> Target Intron 4 >>>> {u}UnkGly : 41 |||||:!!|||! !{ } 69105 bp {!} ... luAsnLeuAlaIle{Ar}-+ ++{g}GlySer 997135 : AGAATCTAGCGATA{AG}at.........................ag{g}ggatct : 928010 42 : ThrThrThrArgAspPheThrGlnLeuAsnGluLeuGln >>>> Target Int : 55 ::: |||::: |||||| |||||| 167116 SerGlnProArgAsnGlnThrGlnSerProThrLeuGln++ 928009 : tcccaacccaggaatcaaacccagtctcccaccttgcaggt............... : 927966 56 : ron 5 >>>> CysArgPheProArgArgLeu{Va} >>>> Target Intro : 62 bp |||||| !||| :::{:!} 50994 bp ++LysArgPheSerArgAlaVal{Il}++ 927965 : ..........agAAGAGATTTAGCAGAgcagtc{at}gt................. : 760827 63 : n 6 >>>> {l}ValLeuGlyPhePro{Cy} >>>> Target Intron 7 > : 68 {!}:::||||||...|||{||} 152227 bp ++{e}IleLeuGlyLeuPro{Cy}++ 760826 : ........ag{c}attcttgggcttccc{tg}gt...................... : 709815 69 : >>> {s}AsnGlnPheGlyHis{Gl} >>>> Target Intron 8 >>>> : 74 {|} ||||||..!! {..} 15070 bp ++{s}AlaGlnPheSerPro{Se}++ ++ 709814 : ...ag{T}GCACAGTTTTCCCCA{AG}gt.........................ag : 542504 75 : {n}GluAsnCysGln >>>> Target Intron 9 >>>> AsnGluGluIle : 82 {.} !!||||||||| 128060 bp :!! !! !:!! {r}***AsnCysGln++ ++AspMetGlyVal 542503 : {C}TAAAACTGTCAGgt.........................agGACATGGGAGTA : 414420 83 : LeuAsnSerLeuLys >>>> Target Intron 10 >>>> TyrValArgPr : 91 ! !|||!!!|||||| 56532 bp ::: || CysAsnThrLeuLys++ ++GlyIlePhePr 414419 : TGTAACACATTAAAGgt..........................aggggatcttccc : 357861 92 : oGlyGlyGlyTyrGlnProThrPheThrLeuValGlnLys{Cy} >>>> Targe : 105 | ||| ...||| ... :!!!:! ! {||} oThrGlnGlySerAsnProCysLeuLeuGlnLeuArgHis{Cy}++ 357860 : gacccagggatcaaacccatgtcttttacaaCTCCGGCAT{TG}gt.......... : 357815 106 : t Intron 11 >>>> {s}GluValAsnGly{Gl} >>>> Target Intro : 110 7444 bp {|}|||:!!!!.|||{::} 68400 bp ++{s}GluIleLysGly{Ar}++ 357814 : ................ag{T}GAGATTAAGGGC{AG}gt................. : 350356 111 : n 12 >>>> {n}Asn{G} >>>> Target Intron 13 >>>> {lu}Hi : 113 {!}|||{ } 29340 bp { !}|| ++{g}Asn{L}++ ++{eu}Hi 350355 : .........ag{A}AAC{T}gt..........................ag{ta}ca : 252611 114 : sProValPheAlaTyrLeuLysAsp{Ly} >>>> Target Intron 14 >>> : 122 | :::::: |||::: {!:} 2068 bp sSerIleTyrMetTyrIleIleTyr{Ar}++ 252610 : tagtatatatatgtacattatatac{ag}gt......................... : 252580 123 : > {s}LeuProTyrProTyrAspAspPro{P} >>>> Target Intron 15 : 131 {!}|||||| |||:::|||...|||{ } 52953 bp ++{g}LeuProArgProTrpAspSerPro{V}+- 252579 : .ag{g}ctcccccgcccctgggattctcca{g}gc..................... : 250486 132 : >>>> {he}Ser{Le} >>>> Target Intron 16 >>>> {u}MetTh : 135 {!!}|||{:!} 20256 bp {!}|||:: ++{al}Ser{Me}++ ++{t}MetSe 250485 : .....ag{tt}tca{aT}gt..........................ag{g}atgtc : 177268 136 : rAspPro{Ly} >>>> Target Intron 17 >>>> {s}LeuIleIleTrp : 142 : {!.} 3536 bp {.}:!!:!!:!! rGlySer{Se}++ +-{r}ValValValAsn 177267 : tggctct{ag}gt..........................aa{T}GTTGTAGTAAAC : 173711 143 : SerProValArgArgSer{A} >>>> Target Intron 18 >>>> {sp}V : 150 |||||||||!.!|||! !{!} 8079 bp { !}| SerProValAsnArg***{A}++ ++{la}V 173710 : TCACCTGTTAACCGCTAA{G}gt..........................ag{CT}G : 165608 151 : alAlaTrp{A} >>>> Target Intron 19 >>>> {sn}PheGlu >>> : 156 || !|||{:} 7444 bp {::}!:!:!! alGlnTrp{S}++ ++{er}TyrLys++ 165607 : TTCAGTGG{T}gt..........................ag{CA}TACAAGgt... : 158144 157 : > Target Intron 20 >>>> LysPheLeuIleGlyProGluGlyGluProP : 166 21138 bp ! !||| !||||||||| !! ||| ++ProThrLeuAlaGlyProGluProGlyProA 158143 : .......................agCCAACCCTGGCCGGGCCAGAGCCGGGTCCAG : 136978 167 : heArgArgTyrSer >>>> Target Intron 21 >>>> ArgThrPhePro : 174 ! !! ! ! ! 25118 bp ||| ||| spAlaThrGlnLeu++ ++ArgIlePheLeu 136977 : ATGCTACACAGCTGgt..........................agaggatcttcctg : 111836 175 : ThrIleAsnIleGluProAspIleLysArgLeuLeu : 186 ||| ... ...||| ::: ...|||||| ThrGlnGlySerAsnProArgLeuProHisLeuLeu 111835 : acccagggatcgaacccacgtctcccgcatctcctg : 111798 vulgar: SPP00000005_1.0 9 186 . NIVO01055543.1 1196025 111797 - 118 M 10 30 S 0 2 5 0 2 I 0 61963 3 0 2 S 1 1 M 8 24 S 0 2 5 0 2 I 0 55038 3 0 2 S 1 1 M 1 3 5 0 2 I 0 81804 3 0 2 M 8 24 S 0 2 5 0 2 I 0 69101 3 0 2 S 1 1 M 15 45 5 0 2 I 0 167112 3 0 2 M 7 21 S 0 2 5 0 2 I 0 50990 3 0 2 S 1 1 M 5 15 S 0 2 5 0 2 I 0 152223 3 0 2 S 1 1 M 5 15 S 0 2 5 0 2 I 0 15066 3 0 2 S 1 1 M 4 12 5 0 2 I 0 128056 3 0 2 M 9 27 5 0 2 I 0 56528 3 0 2 M 17 51 S 0 2 5 0 2 I 0 7440 3 0 2 S 1 1 M 4 12 S 0 2 5 0 2 I 0 68396 3 0 2 S 1 1 M 1 3 S 0 1 5 0 2 I 0 29336 3 0 2 S 1 2 M 9 27 S 0 2 5 0 2 I 0 2064 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 52949 3 0 2 S 1 2 M 1 3 S 0 2 5 0 2 I 0 20252 3 0 2 S 1 1 M 4 12 S 0 2 5 0 2 I 0 3532 3 0 2 S 1 1 M 10 30 S 0 1 5 0 2 I 0 8075 3 0 2 S 1 2 M 3 9 S 0 1 5 0 2 I 0 7440 3 0 2 S 1 2 M 2 6 5 0 2 I 0 21134 3 0 2 M 15 45 5 0 2 I 0 25114 3 0 2 M 16 48 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 111798 1196025 118 - . gene_id 6 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1195994 1196025 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1195994 1196025 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1195992 1195993 . - . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1134027 1195993 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1134027 1134028 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1134000 1134026 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1134000 1134026 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1133998 1133999 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1078958 1133999 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1078958 1078959 . - . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1078954 1078957 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1078954 1078957 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1078952 1078953 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 997146 1078953 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 997146 997147 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 997120 997145 . - . NIVO01055543.1 exonerate:protein2genome:local exon 997120 997145 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 997118 997119 . - . intron_id 4 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 928015 997119 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 928015 928016 . - . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 927969 928014 . - . NIVO01055543.1 exonerate:protein2genome:local exon 927969 928014 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 927967 927968 . - . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 760853 927968 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 760853 760854 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 760830 760852 . - . NIVO01055543.1 exonerate:protein2genome:local exon 760830 760852 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 760828 760829 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 709836 760829 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 709836 709837 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 709818 709835 . - . NIVO01055543.1 exonerate:protein2genome:local exon 709818 709835 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 709816 709817 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 557591 709817 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 557591 557592 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 557573 557590 . - . NIVO01055543.1 exonerate:protein2genome:local exon 557573 557590 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 557571 557572 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 542503 557572 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 542503 542504 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 542490 542502 . - . NIVO01055543.1 exonerate:protein2genome:local exon 542490 542502 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 542488 542489 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 414430 542489 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 414430 414431 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 414403 414429 . - . NIVO01055543.1 exonerate:protein2genome:local exon 414403 414429 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 414401 414402 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 357871 414402 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 357871 357872 . - . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 357818 357870 . - . NIVO01055543.1 exonerate:protein2genome:local exon 357818 357870 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 357816 357817 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 350374 357817 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 350374 350375 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 350359 350373 . - . NIVO01055543.1 exonerate:protein2genome:local exon 350359 350373 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 350357 350358 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 281959 350358 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 281959 281960 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 281954 281958 . - . NIVO01055543.1 exonerate:protein2genome:local exon 281954 281958 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 281952 281953 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 252614 281953 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 252614 252615 . - . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 252583 252613 . - . NIVO01055543.1 exonerate:protein2genome:local exon 252583 252613 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 252581 252582 . - . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 250515 252582 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 250515 250516 . - . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 250489 250514 . - . NIVO01055543.1 exonerate:protein2genome:local exon 250489 250514 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 250487 250488 . - . intron_id 15 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 197536 250488 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 197536 197537 . - . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 197529 197535 . - . NIVO01055543.1 exonerate:protein2genome:local exon 197529 197535 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 197527 197528 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 177273 197528 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 177273 177274 . - . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 177258 177272 . - . NIVO01055543.1 exonerate:protein2genome:local exon 177258 177272 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 177256 177257 . - . intron_id 17 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 173722 177257 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 173722 173723 . - . intron_id 16 ; splice_site "AA" NIVO01055543.1 exonerate:protein2genome:local cds 173690 173721 . - . NIVO01055543.1 exonerate:protein2genome:local exon 173690 173721 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 173688 173689 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 165611 173689 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 165611 165612 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 165599 165610 . - . NIVO01055543.1 exonerate:protein2genome:local exon 165599 165610 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 165597 165598 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 158155 165598 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 158155 158156 . - . intron_id 18 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 158147 158154 . - . NIVO01055543.1 exonerate:protein2genome:local exon 158147 158154 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 158145 158146 . - . intron_id 20 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 137009 158146 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 137009 137010 . - . intron_id 19 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 136964 137008 . - . NIVO01055543.1 exonerate:protein2genome:local exon 136964 137008 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 136962 136963 . - . intron_id 21 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 111846 136963 . - . intron_id 21 NIVO01055543.1 exonerate:protein2genome:local splice3 111846 111847 . - . intron_id 20 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 111798 111845 . - . NIVO01055543.1 exonerate:protein2genome:local exon 111798 111845 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 111798 1196025 118 - . alignment_id 6 ; Query SPP00000005_1.0 ; Align 1196026 10 30 ; Align 1134026 21 24 ; Align 1078957 30 3 ; Align 997146 31 24 ; Align 928014 40 45 ; Align 760853 55 21 ; Align 709835 63 15 ; Align 557590 69 15 ; Align 542502 75 12 ; Align 414430 79 27 ; Align 357871 88 51 ; Align 350373 106 12 ; Align 281958 111 3 ; Align 252612 113 27 ; Align 250514 123 24 ; Align 197534 132 3 ; Align 177272 134 12 ; Align 173721 139 30 ; Align 165609 150 9 ; Align 158153 154 6 ; Align 137009 156 45 ; Align 111846 171 48 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 116 Query range: 6 -> 176 Target range: 1096097 -> 7403 7 : SerPheTyrAspLeuSerAlaIleSerLeuAsp{Gl} >>>> Target Intro : 18 |||!:! !..!||||||!.!.!!.!!:!!!!:{ !} 74818 bp SerTyrValSerLeuSerValPheGlyIleGlu{Ar}++ 1096097 : TCTTATGTCAGTTTATCTGTATTTGGAATAGAG{AG}gt................. : 1096060 19 : n 1 >>>> {y}GluLysValAspPheAsnThrPheArg{G} >>>> Target : 28 {!}||| !!.!! |||!.!||||||{|} 141 ++{g}GluAlaAlaGlyGluAsnAsnPheArg{G}++ 1096059 : ........ag{A}GAAGCAGCAGGAGAAAACAATTTCAGA{G}gt........... : 1021213 29 : Intron 2 >>>> {ly}{A} >>>> Target Intron 3 >>>> {rg} : 29 409 bp {||}{|} 184107 bp {||} ++{ly}{A}++ +-{rg} 1021212 : ..............ag{GT}{A}gt.........................at{GA} : 695696 30 : AlaValLeuIleGlu >>>> Target Intron 4 >>>> AsnValAlaSer : 38 !:!!|||:!!||| 127977 bp :!!:!::::||| AsnLeuLeuLeuGlu++ ++AspIleSerSer 695695 : AATCTGCTCTTAGAGgt.........................agGATATcagctct : 567693 39 : {Le} >>>> Target Intron 5 >>>> {u}UnkGlyThrThrThrArgAs : 46 { } 155416 bp {!} ...::: ||||| {Ar}++ ++{g}GlySerSerArgProArgAs 567692 : {ag}gt.........................ag{g}ggatcttcccgacccagaga : 412253 47 : pPheThrGln >>>> Target Intron 6 >>>> LeuAsnGluLeuGlnCy : 55 | |||||| 6232 bp :::::::::|||:::|| p***ThrGln++ ++MetSerLysLeuArgCy 412252 : ttgaactcaggt.........................agatgagcaaactgagatg : 405994 56 : sArg{Ph} >>>> Target Intron 7 >>>> {e}ProArg{A} >>>> : 60 ||||{ } 42870 bp { }|||!:!{ } sArg{Ly}-+ ++{s}ProGln{G}++ 405993 : CAGA{AA}tt.........................ag{G}CCTCAG{G}gt..... : 363106 61 : Target Intron 8 >>>> {rg}LeuVal{Va} >>>> Target Intron : 63 8350 bp {!!}|||:!!{ } 45831 bp ++{ly}LeuIle{Cy}++ 363105 : ....................ag{GT}CTTATC{TG}gt.................. : 354746 64 : 9 >>>> {l}LeuGlyPheProCysAsnGlnPheGlyHisGln{G} >>>> T : 75 {!}:::...|||||| :::|||||| ...{!} ++{s}MetSerPheProMetSerGlnPhePheThrSer{G}++ 354745 : .......ag{c}atgtcttttccaatgagccagttcttcacatca{g}gt...... : 308880 76 : arget Intron 10 >>>> {lu}AsnCysGlnAsnGluGluIleLeuAsnSer : 85 56590 bp { !}::: ||| ||| ||| ++{ly}AspLeuProAsnProGlyIleLysProSer 308879 : ....................ag{gg}gatcttcctaacccagggatcaaacccagt : 252263 86 : LeuLysTyrVal{Ar} >>>> Target Intron 11 >>>> {g}ProGlyG : 93 ||| ::: {||} 7852 bp {|}|||||| LeuProHisCys{Ar}++ ++{g}ProGlyG 252262 : ctcccacattgc{ag}gt..........................ag{a}ccagggc : 244387 94 : ly >>>> Target Intron 12 >>>> GlyTyrGlnProThr{Ph} >>> : 99 ! 19547 bp ||| ||||||{ } ln++ ++GlySerPheProThr{Gl}+- 244386 : aGgt..........................aggggagcttcccgacc{ca}gg... : 224818 100 : > Target Intron 13 >>>> {e}ThrLeuValGlnLysCysGluValAsn{ : 109 78486 bp { }||| !|||...!:! ||| !|||{ ++{n}ThrGlyValSerArgLysGluProAsn{ 224817 : .......................ag{G}ACGGGTGTGTCTAGAAAAGAGCCAAAC{ : 146306 110 : Gl} >>>> Target Intron 14 >>>> {y}GlnAsnGluHisProValPh : 116 !} 30558 bp {!}...|||.!.|||||| !|| Ar}++ ++{g}SerAsnHisHisProLysPh 146305 : AG}gt..........................ag{A}AGTAACCACCATCCTAAATT : 115727 117 : e{A} >>>> Target Intron 15 >>>> {la}TyrLeuLysAsp{Ly} : 122 |{!} 34387 bp {.!} ||| {!:} e{G}++ ++{ly}CysLeuIleThr{Ar}++ 115726 : T{G}gt..........................ag{ga}tgtctgatcact{ag}gt : 81320 123 : >>>> Target Intron 16 >>>> {s}LeuProTyrProTyrAspAspPro{ : 131 24181 bp {!}|||||| |||:::|||...|||{ ++{g}LeuProArgProTrpAspSerPro{ 81319 : ..........................ag{a}ctcccccgtccctgggattctcca{ : 57114 132 : P} >>>> Target Intron 17 >>>> {he}SerLeuMetThrAspProLy : 138 } 6148 bp {! }||||||! !!!!:|||! V}+- ++{al}SerLeuThrProGluProTh 57113 : g}gc..........................ag{TG}AGCCTAACTCCAGAGCCCAC : 50945 139 : sLeuIleIleTrpSerProValArgArg{Se} >>>> Target Intron 18 : 148 ! ! !||| ! !:!||||||!:!|||{..} 18553 bp rAlaCysIleArgAsnProValGlnArg{Gl}++ 50944 : AGCATGTATTCGAAACCCAGTGCAACGC{CA}gt...................... : 50911 149 : >>>> {r}AspValAlaTrpAsn >>>> Target Intron 19 >>>> Ph : 154 {!}|||..!||| !!.!. 24872 bp ++{n}AspThrAlaGlyGln+- ++Al 50910 : ....ag{G}GACACGGCAGGGCAGga..........................aggc : 7472 155 : eGluLysPheLeuIleGlyProGluGlyGluProPheArgArgTyrSerArgThrP : 173 :::...... ||| |||:::|||||| ||| |||!:!! ! aAspSerLeuProAlaGluProProGlyLysProPheValArgIleSerLysLysT 7471 : agattccctaccagctgagccaccagggaagccctttgtaagGATAAGTAAAAAAA : 7415 174 : heProThrIle : 176 ! !|||:!: hrHisThrVal 7414 : CGCACACTGTG : 7404 vulgar: SPP00000005_1.0 6 176 . NIVO01055543.1 1096097 7403 - 116 M 11 33 S 0 2 5 0 2 I 0 74814 3 0 2 S 1 1 M 9 27 S 0 1 5 0 2 I 0 141405 3 0 2 S 1 3 5 0 2 I 0 184103 3 0 2 S 1 2 M 5 15 5 0 2 I 0 127973 3 0 2 M 4 12 S 0 2 5 0 2 I 0 155412 3 0 2 S 1 1 M 10 30 5 0 2 I 0 6228 3 0 2 M 7 21 S 0 2 5 0 2 I 0 42866 3 0 2 S 1 1 M 2 6 S 0 1 5 0 2 I 0 8346 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 45827 3 0 2 S 1 1 M 11 33 S 0 1 5 0 2 I 0 56586 3 0 2 S 1 2 M 14 42 S 0 2 5 0 2 I 0 7848 3 0 2 S 1 1 M 3 9 5 0 2 I 0 19543 3 0 2 M 5 15 S 0 2 5 0 2 I 0 78482 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 30554 3 0 2 S 1 1 M 7 21 S 0 1 5 0 2 I 0 34383 3 0 2 S 1 2 M 4 12 S 0 2 5 0 2 I 0 24177 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 6144 3 0 2 S 1 2 M 16 48 S 0 2 5 0 2 I 0 18549 3 0 2 S 1 1 M 5 15 5 0 2 I 0 24868 3 0 2 M 23 69 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 7404 1096097 116 - . gene_id 7 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1096063 1096097 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1096063 1096097 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1096061 1096062 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1021245 1096062 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1021245 1021246 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1021216 1021244 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1021216 1021244 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1021214 1021215 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 879807 1021215 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 879807 879808 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 879804 879806 . - . NIVO01055543.1 exonerate:protein2genome:local exon 879804 879806 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 879802 879803 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 695697 879803 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 695697 695698 . - . intron_id 2 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local cds 695680 695696 . - . NIVO01055543.1 exonerate:protein2genome:local exon 695680 695696 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 695678 695679 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 567703 695679 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 567703 567704 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 567689 567702 . - . NIVO01055543.1 exonerate:protein2genome:local exon 567689 567702 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 567687 567688 . - . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 412273 567688 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 412273 412274 . - . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 412242 412272 . - . NIVO01055543.1 exonerate:protein2genome:local exon 412242 412272 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 412240 412241 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 406010 412241 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 406010 406011 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 405987 406009 . - . NIVO01055543.1 exonerate:protein2genome:local exon 405987 406009 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 405985 405986 . - . intron_id 7 ; splice_site "TT" NIVO01055543.1 exonerate:protein2genome:local intron 363117 405986 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 363117 363118 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 363109 363116 . - . NIVO01055543.1 exonerate:protein2genome:local exon 363109 363116 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 363107 363108 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 363108 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 308918 354748 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 308918 308919 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 308883 308917 . - . NIVO01055543.1 exonerate:protein2genome:local exon 308883 308917 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 308881 308882 . - . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 252293 308882 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 252293 252294 . - . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 252247 252292 . - . NIVO01055543.1 exonerate:protein2genome:local exon 252247 252292 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 252245 252246 . - . intron_id 11 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 244395 252246 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 244395 244396 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 244385 244394 . - . NIVO01055543.1 exonerate:protein2genome:local exon 244385 244394 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 244383 244384 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 224838 244384 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 224838 224839 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 224821 224837 . - . NIVO01055543.1 exonerate:protein2genome:local exon 224821 224837 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 224819 224820 . - . intron_id 13 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 146335 224820 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 146335 146336 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 146305 146334 . - . NIVO01055543.1 exonerate:protein2genome:local exon 146305 146334 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 146303 146304 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 115747 146304 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 115747 115748 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 115724 115746 . - . NIVO01055543.1 exonerate:protein2genome:local exon 115724 115746 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 115722 115723 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 81337 115723 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 81337 81338 . - . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 81321 81336 . - . NIVO01055543.1 exonerate:protein2genome:local exon 81321 81336 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 81319 81320 . - . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 57140 81320 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 57140 57141 . - . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 57114 57139 . - . NIVO01055543.1 exonerate:protein2genome:local exon 57114 57139 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 57112 57113 . - . intron_id 17 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 50966 57113 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 50966 50967 . - . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 50914 50965 . - . NIVO01055543.1 exonerate:protein2genome:local exon 50914 50965 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 50912 50913 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 32361 50913 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 32361 32362 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 32345 32360 . - . NIVO01055543.1 exonerate:protein2genome:local exon 32345 32360 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 32343 32344 . - . intron_id 19 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 7473 32344 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 7473 7474 . - . intron_id 18 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 7404 7472 . - . NIVO01055543.1 exonerate:protein2genome:local exon 7404 7472 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 7404 1096097 116 - . alignment_id 7 ; Query SPP00000005_1.0 ; Align 1096098 7 33 ; Align 1021244 19 27 ; Align 695695 30 15 ; Align 567703 35 12 ; Align 412272 40 30 ; Align 406010 50 21 ; Align 363116 58 6 ; Align 354757 61 6 ; Align 308917 64 33 ; Align 252291 76 42 ; Align 244394 91 9 ; Align 224838 94 15 ; Align 146334 100 27 ; Align 115746 110 21 ; Align 81335 118 12 ; Align 57139 123 24 ; Align 50964 132 48 ; Align 32360 149 15 ; Align 7473 154 69 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 115 Query range: 0 -> 188 Target range: 1204657 -> 188561 1 : MetAlaPheIleAlaLysSerPheTyr{As} >>>> Target Intron 1 >> : 10 ::: |||||||||:!!|||.!. {..} 29990 bp LeuIlePheIleAlaGlnSerLeuVal{Se}++ 1204657 : ttaatttttatagctCAGTCTCTGGTG{AG}gt....................... : 1204626 11 : >> {p}LeuSerAlaIleSerLeuAspGlyGluLysValAspPheAsn{T} >> : 25 {!} ...::::!:||||||||||||! ...|||..!.!....{ } ++{r}HisGluSerLeuSerLeuAspGlyValSerValSerLeuGly{G}-+ 1204625 : ..ag{c}catgaaagccTGAGCTTAGATGGAGTTTCCGTGAGCCTGGGA{G}ct.. : 1174592 26 : >> Target Intron 2 >>>> {hr}PheArgGlyArgAlaValLeu >>>> : 33 28739 bp { !}|||:::||||||... ||| ++{lu}PheGlnGlyArgGlySerLeu++ 1174591 : .......................ag{aa}ttccagggacgggggagcctggt.... : 1145830 34 : Target Intron 3 >>>> IleGluAsnValAlaSerLeuUnkGlyThr{T} : 43 6791 bp ||| !:!!:!! ! !!! ! !|||{ } ++IleThrAspIlePheProTyrMet***Thr{G} 1145829 : .....................agATTACAGATATCTTTCCATACATGTAGACA{G} : 1139011 44 : >>>> Target Intron 4 >>>> {hr}ThrArgAspPheThrGlnLeuAs : 51 102703 bp { !}!.!||||||.!.|||.!.|||.! ++ ++{ly}AsnArgAspIleThrAsnLeuGl 1139010 : gt.........................ag{GA}AACAGGGATATAACCAACCTGGA : 1036284 52 : nGluLeuGln{C} >>>> Target Intron 5 >>>> {ys}{A} >>>> : 56 . :!!...{|} 156465 bp {||}{|} uThrValSer{C}++ ++{ys}{A}++ 1036283 : AACTGTATCC{T}gt.........................ag{GT}{A}gt..... : 879801 57 : Target Intron 6 >>>> {rg}PhePro{Ar} >>>> Target Intron : 59 60931 bp {||}||||||{||} 68699 bp ++{rg}PhePro{Ar}+- 879800 : ....................ag{ga}tttccc{ag}gc.................. : 818860 60 : 7 >>>> {g}ArgLeu{V} >>>> Target Intron 8 >>>> {al}Va : 63 {|}!:! !{:} 15015 bp {!!} ++{g}LysLys{L}++ ++{eu}Ph 818859 : .......ag{G}AAAAAA{T}gt.........................ag{ta}tt : 735138 64 : lLeuGlyPheProCysAsnGlnPhe{G} >>>> Target Intron 9 >>>> : 72 ||||||||| |||...... {|} 21389 bp eLeuGlyPheSerCysGlySerAla{G}++ + 735137 : cttgggcttctcttgtggctcagct{g}gt.........................a : 713723 73 : {ly}HisGlnGlu >>>> Target Intron 10 >>>> AsnCysGlnAsn : 79 {||}||| !:!! 81198 bp !!.|||..!... +{ly}HisAlaGln-+ ++LysCysSerGly 713722 : g{GA}CATGCACAGtt..........................agAAGTGTTCAGGA : 632503 80 : GluGluIle >>>> Target Intron 11 >>>> LeuAsnSerLeuLysTy : 88 ...!!: 20224 bp ::: |||:::|| SerAspGln++ ++TyrSerCysLeuGluTy 632502 : TCTGACCAGgt..........................agtactcttgcctggagta : 612252 89 : rValArgProGlyGlyGly{Ty} >>>> Target Intron 12 >>>> {r} : 95 | ||| ||||||...{!:} 105243 bp {:} rProArgAspGlyGlyAla{Tr}++ ++{p} 612251 : tcccagggacgggggagcc{tg}gt..........................ag{G} : 506986 96 : GlnProThrPheThrLeuVal{Gl} >>>> Target Intron 13 >>>> { : 103 ! |||!.! !|||!!!:!!{! } 47411 bp { LeuProAsnAlaThrPheLeu{Le}++ ++{ 506985 : CTTCCAAATGCCACCTTTTTG{CT}gt..........................ag{ : 459551 104 : n}LysCysGluValAsnGlyGlnAsnGlu{H} >>>> Target Intron 14 : 113 }|||||| :!!!..||| ! ! |||{ } 100448 bp u}LysCysPheIleArgGlyLeu***Glu{T}++ 459550 : T}AAGTGTTTTATTAGAGGATTATAGGAA{A}gt...................... : 459520 114 : >>>> {is}ProValPheAlaTyrLeuLysAspLysLeuPro{Ty} >>>> Ta : 125 { !}||| ! ! !!||||||...||| !:!!|||{!!} ++{hr}ProGlnAlaProTyrLeuSerAspLeuIlePro{**}++ 459519 : ....ag{CT}CCACAGGCCCCTTACCTTTCTGACTTGATCCCT{TA}gt....... : 359035 126 : rget Intron 15 >>>> {r}ProTyrAsp >>>> Target Intron 16 : 129 4279 bp { } !!||| 4806 bp ++{*}SerTyrLeu++ 359034 : ...................ag{G}TCTTATCTGgt..................... : 354746 130 : >>>> >>>> Target Intron 17 >>>> >>>> Target Intro : 129 8309 bp 73826 bp ++++ ++++ 354745 : .....aggt..........................aggt................. : 341631 130 : n 18 >>>> AspProPheSerLeuMetThrAspProLysLeuIleIleTrpSer : 143 !!: !.!!|||:!! !! ||| !:!! !:!:||| ! ++GluIleIleSerIleCysLeuGlyPro***ValSerValTrpLeu 341630 : .........agGAGATAATCTCTATTTGCCTGGGGCCTTGAGTGTCAGTGTGGCTT : 267765 144 : ProValArgArgSerAspValAlaTrpAsnPhe{G} >>>> Target Intron : 155 !!|||||| !.!! !!..! ! !||| !{.} 3271 bp ThrValArgAlaGlyHisThrArgLysAsnHis{S}++ 267764 : ACAGTGAGGGCAGGCCACACCAGAAAGAACCAC{A}gt.................. : 267726 156 : 19 >>>> {lu}LysPheLeuIleGlyPro{G} >>>> Target Intron : 162 {..}|||||||||! !! !!{!} 29926 bp ++{er}LysPheLeuArgArgAla{A}++ 267725 : ........ag{GC}AAGTTTCTGAGGAGAGCA{G}gt................... : 264434 163 : 20 >>>> {lu}GlyGluProPheArgArgTyrSerArgThrPheProThrIleA : 177 {!:} ! !!|||! !!:!|||||| !:!!|||! !! ! !! ++{sp}ProCysSerPheLeuLysTyrSerTyrSerPheLeuLysTyrS 264433 : .......ag{AT}CCCTGCTCATTCCTTAAGTATAGTTACTCATTCCTTAAATATA : 234466 178 : snIle >>>> Target Intron 21 >>>> GluProAspIleLysArgLeu : 185 :!! ! 45869 bp |||||| :::||| ||| erAsn++ ++GluProPheLeuLysSerLeu 234465 : GTAATgt..........................aggaaccatttttaaagtcttta : 188573 186 : LeuLysVal : 188 |||...::: LeuAsnLeu 188572 : ctgaatttg : 188562 vulgar: SPP00000005_1.0 0 188 . NIVO01055543.1 1204657 188561 - 115 M 9 27 S 0 2 5 0 2 I 0 29986 3 0 2 S 1 1 M 14 42 S 0 1 5 0 2 I 0 28735 3 0 2 S 1 2 M 7 21 5 0 2 I 0 6787 3 0 2 M 10 30 S 0 1 5 0 2 I 0 102699 3 0 2 S 1 2 M 11 33 S 0 1 5 0 2 I 0 156461 3 0 2 S 1 3 5 0 2 I 0 60927 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 68695 3 0 2 S 1 1 M 2 6 S 0 1 5 0 2 I 0 15011 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 21385 3 0 2 S 1 2 M 3 9 5 0 2 I 0 81194 3 0 2 M 7 21 5 0 2 I 0 20220 3 0 2 M 12 36 S 0 2 5 0 2 I 0 105239 3 0 2 S 1 1 M 7 21 S 0 2 5 0 2 I 0 47407 3 0 2 S 1 1 M 9 27 S 0 1 5 0 2 I 0 100444 3 0 2 S 1 2 M 11 33 S 0 2 5 0 2 I 0 4275 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 73822 3 0 2 M 26 78 S 0 1 5 0 2 I 0 3267 3 0 2 S 1 2 M 6 18 S 0 1 5 0 2 I 0 29922 3 0 2 S 1 2 M 16 48 5 0 2 I 0 45865 3 0 2 M 10 30 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 188562 1204657 115 - . gene_id 8 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1204629 1204657 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1204629 1204657 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1204627 1204628 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1174639 1204628 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1174639 1174640 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1174595 1174638 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1174595 1174638 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1174593 1174594 . - . intron_id 2 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 1145856 1174594 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1145856 1145857 . - . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1145833 1145855 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1145833 1145855 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1145831 1145832 . - . intron_id 3 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1139042 1145832 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1139042 1139043 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1139011 1139041 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1139011 1139041 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1139009 1139010 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1036308 1139010 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 1036308 1036309 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1036272 1036307 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1036272 1036307 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1036270 1036271 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 879807 1036271 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 879807 879808 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 879804 879806 . - . NIVO01055543.1 exonerate:protein2genome:local exon 879804 879806 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 879802 879803 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 818873 879803 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 818873 818874 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 818863 818872 . - . NIVO01055543.1 exonerate:protein2genome:local exon 818863 818872 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 818861 818862 . - . intron_id 7 ; splice_site "gc" NIVO01055543.1 exonerate:protein2genome:local intron 750164 818862 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 750164 750165 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 750156 750163 . - . NIVO01055543.1 exonerate:protein2genome:local exon 750156 750163 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 750154 750155 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 735141 750155 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 735141 735142 . - . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 735111 735140 . - . NIVO01055543.1 exonerate:protein2genome:local exon 735111 735140 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 735109 735110 . - . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 713722 735110 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 713722 713723 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 713711 713721 . - . NIVO01055543.1 exonerate:protein2genome:local exon 713711 713721 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 713709 713710 . - . intron_id 10 ; splice_site "TT" NIVO01055543.1 exonerate:protein2genome:local intron 632513 713710 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 632513 632514 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 632492 632512 . - . NIVO01055543.1 exonerate:protein2genome:local exon 632492 632512 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 632490 632491 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 612268 632491 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 612268 612269 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 612230 612267 . - . NIVO01055543.1 exonerate:protein2genome:local exon 612230 612267 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 612228 612229 . - . intron_id 12 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 506987 612229 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 506987 506988 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 506963 506986 . - . NIVO01055543.1 exonerate:protein2genome:local exon 506963 506986 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 506961 506962 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 459552 506962 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 459552 459553 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 459523 459551 . - . NIVO01055543.1 exonerate:protein2genome:local exon 459523 459551 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 459521 459522 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 359075 459522 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 359075 359076 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 359038 359074 . - . NIVO01055543.1 exonerate:protein2genome:local exon 359038 359074 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 359036 359037 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 359037 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 16 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 267808 341633 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 267808 267809 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 267729 267807 . - . NIVO01055543.1 exonerate:protein2genome:local exon 267729 267807 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 267727 267728 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 264458 267728 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 264458 264459 . - . intron_id 18 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 264437 264457 . - . NIVO01055543.1 exonerate:protein2genome:local exon 264437 264457 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 264435 264436 . - . intron_id 20 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 234511 264436 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 234511 234512 . - . intron_id 19 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 234461 234510 . - . NIVO01055543.1 exonerate:protein2genome:local exon 234461 234510 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 234459 234460 . - . intron_id 21 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 188592 234460 . - . intron_id 21 NIVO01055543.1 exonerate:protein2genome:local splice3 188592 188593 . - . intron_id 20 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 188562 188591 . - . NIVO01055543.1 exonerate:protein2genome:local exon 188562 188591 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 188562 1204657 115 - . alignment_id 8 ; Query SPP00000005_1.0 ; Align 1204658 1 27 ; Align 1174638 11 42 ; Align 1145854 26 21 ; Align 1139042 33 30 ; Align 1036306 44 33 ; Align 818871 57 6 ; Align 750163 60 6 ; Align 735139 63 27 ; Align 713720 73 9 ; Align 632513 76 21 ; Align 612268 83 36 ; Align 506986 96 21 ; Align 459551 104 27 ; Align 359073 114 33 ; Align 354758 126 9 ; Align 267808 129 78 ; Align 264456 156 18 ; Align 234509 163 48 ; Align 188592 179 30 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 111 Query range: 27 -> 180 Target range: 1229280 -> 268001 28 : GlyArgAlaValLeuIleGluAsnValAlaSerLeuUnkGlyThrThrThrArgAs : 46 |||::::::... :::... :::||||||::: |||:::|| GlyGlnSerThrArgValSerAlaLeuAlaSerValLeuProMetLysThrGlnAs 1229280 : ggtcaaagtactagagtttcagctttagcatcagtccttccaatgaaaacccagga : 1229226 47 : pPheThrGlnLeuAsnGluLeu >>>> Target Intron 1 >>>> GlnCy : 55 | ::: |||||| ||| 19658 bp ||| p***SerProLeuAsnGlyLeu++ ++GlnLe 1229225 : ctgatctcctttaaatggattggt.........................agCAGCT : 1209541 56 : sArgPheProArgArgLeu{V} >>>> Target Intron 2 >>>> {al}V : 63 !:! !!||||||! ! !{|} 12472 bp {||} uGlnValProArgThrGlu{V}++ ++{al}P 1209540 : GCAAGTTCCTAGAACTGAA{G}gt.........................ag{tg}t : 1197045 64 : alLeuGlyPheProCysAsnGlnPheGlyHisGlnGluAsnCysGln >>>> Ta : 79 ||||||||||||||| ... ||| :::... |||... heLeuGlyPheProCysAlaSerAlaGlyLysGluSerAlaCysAsn++ 1197044 : tcttgggcttcccttgtgcctcagctggtaaagaatctgcctgcaatgt....... : 1196995 80 : rget Intron 3 >>>> AsnGluGluIleLeuAsnSerLeu{L} >>>> Ta : 87 190362 bp !:!:!! !:!!||| ! !.!|||{:} ++SerLysMetLeuLeu***LysLeu{G}++ 1196994 : ..................agAGTAAGATGCTTTTGTAGAAATTG{G}gt....... : 1006608 88 : rget Intron 4 >>>> {ys}TyrValArgProGlyGly{Gl} >>>> Tar : 94 108910 bp {!!} !!|||!.!|||||||||{ !} ++{lu}AspValAsnProGlyGly{Ar}-+ 1006607 : ..................ag{AG}GATGTGAACCCTggagga{ag}at........ : 897676 95 : get Intron 5 >>>> {y}TyrGlnPro{Th} >>>> Target Intron : 98 27281 bp {!} ||||||{ } 6540 bp ++{g}ValGlnPro{Ar}++ 897675 : .................ag{g}gtccagccc{cg}gt................... : 870383 99 : 6 >>>> {r}PheThr >>>> Target Intron 7 >>>> LeuValGlnL : 104 {!}|||||| 3437 bp :!!:!!:!!| ++{g}PheThr++ ++IleLeuGluL 870382 : ......ag{a}tttacAgt.........................agATCCTTGAGA : 860392 105 : ysCys{G} >>>> Target Intron 8 >>>> {lu}ValAsnGlyGln{A} : 111 || {|} 16643 bp {||}|||!:!||| !{.} ysThr{G}++ ++{lu}ValSerGlyGly{G} 860391 : AAACA{G}gt.........................ag{AA}GTCAGTGGAGGA{G} : 843728 112 : >>>> Target Intron 9 >>>> {sn}GluHisProValPheAlaTyrLe : 119 185735 bp {!.}...||| |||||| :::.. ++ ++{lu}AsnHisPheValPheLeuHisPh 843727 : gt.........................ag{ag}aaccattttgtatttttgcattt : 657969 120 : uLysAspLysLeu{Pr} >>>> Target Intron 10 >>>> {o}TyrPro : 126 ....::: |||{ } 22988 bp {!} ! eSerGluHisLeu{**}++ ++{*}IleAsn 657968 : ctccgagcatctc{tg}gt..........................ag{a}attaAT : 634960 127 : TyrAspAspProPheSerLeuMetThrAspProLysLeu >>>> Target Int : 140 !.!. !|||!:!||| !.!.:!!||| !!!:!||| 87501 ValGlnThrProTyrSerAlaPheSerAspThrArgLeu+- 634959 : GTCCAAACTCCCTATTCAGCCTTTTCTGACACCAGGCTGga............... : 634916 141 : ron 11 >>>> IleIleTrpSerProValArgArgSer{As} >>>> Targe : 149 bp .....!|||..!|||:!! ! !|||{..} 1 ++PhePheTrpGluProIleAlaValSer{Se}+- 634915 : ...........agttcttCTGGGAGCCTATTGCTGTTTCC{AG}ga.......... : 547386 150 : t Intron 12 >>>> {p}ValAlaTrpAsnPheGluLysPhe >>>> Targ : 158 73724 bp {!}:!!.!!|||:!!.!!! ! ++{r}IleThrTrpHisIleAlaThrGln++ 547385 : ................ag{C}ATCACCTGGCACATTGCTACTCAGgt......... : 373637 159 : et Intron 13 >>>> >>>> Target Intron 14 >>>> >>>> : 158 23697 bp 8309 bp ++++ ++++ 373636 : .................aggt..........................aggt..... : 341631 159 : Target Intron 15 >>>> LeuIleGlyProGluGlyGluProPheArgArg : 168 73563 bp !:!!||||||! |||! ||| ! !! !! ++GlyValGlyProAlaGlyGlyProSerCys*** 341630 : .....................agGGAGTAGGCCCGGCTGGAGGTCCCAGCTGCTGA : 268040 169 : TyrSerArgThrPheProThrIleAsnIleGluPro : 180 ! !!..!:!! ||||||:!!!.!:!:..!||| ProProGluSerThrProThrLeuThrLeuArgPro 268039 : CCCCCAGAATCTACGCCCACACTCACTCTGAGACCA : 268002 vulgar: SPP00000005_1.0 27 180 . NIVO01055543.1 1229280 268001 - 111 M 26 78 5 0 2 I 0 19654 3 0 2 M 8 24 S 0 1 5 0 2 I 0 12468 3 0 2 S 1 2 M 16 48 5 0 2 I 0 190358 3 0 2 M 8 24 S 0 1 5 0 2 I 0 108906 3 0 2 S 1 2 M 6 18 S 0 2 5 0 2 I 0 27277 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 6536 3 0 2 S 1 1 M 2 6 5 0 2 I 0 3433 3 0 2 M 5 15 S 0 1 5 0 2 I 0 16639 3 0 2 S 1 2 M 4 12 S 0 1 5 0 2 I 0 185731 3 0 2 S 1 2 M 12 36 S 0 2 5 0 2 I 0 22984 3 0 2 S 1 1 M 15 45 5 0 2 I 0 87497 3 0 2 M 9 27 S 0 2 5 0 2 I 0 173720 3 0 2 S 1 1 M 8 24 5 0 2 I 0 23693 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 73559 3 0 2 M 23 69 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 268002 1229280 111 - . gene_id 9 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1229203 1229280 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1229203 1229280 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1229201 1229202 . - . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1209545 1229202 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1209545 1209546 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1209520 1209544 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1209520 1209544 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1209518 1209519 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1197048 1209519 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1197048 1197049 . - . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1196998 1197047 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1196998 1197047 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1196996 1196997 . - . intron_id 3 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1006636 1196997 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1006636 1006637 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1006611 1006635 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1006611 1006635 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1006609 1006610 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 897701 1006610 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 897701 897702 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 897679 897700 . - . NIVO01055543.1 exonerate:protein2genome:local exon 897679 897700 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 897677 897678 . - . intron_id 5 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local intron 870398 897678 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 870398 870399 . - . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 870386 870397 . - . NIVO01055543.1 exonerate:protein2genome:local exon 870386 870397 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 870384 870385 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 863846 870385 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 863846 863847 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 863839 863845 . - . NIVO01055543.1 exonerate:protein2genome:local exon 863839 863845 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 863837 863838 . - . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 860402 863838 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 860402 860403 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 860386 860401 . - . NIVO01055543.1 exonerate:protein2genome:local exon 860386 860401 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 860384 860385 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 843743 860385 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 843743 843744 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 843728 843742 . - . NIVO01055543.1 exonerate:protein2genome:local exon 843728 843742 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 843726 843727 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 657993 843727 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 657993 657994 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 657953 657992 . - . NIVO01055543.1 exonerate:protein2genome:local exon 657953 657992 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 657951 657952 . - . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 634965 657952 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 634965 634966 . - . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 634919 634964 . - . NIVO01055543.1 exonerate:protein2genome:local exon 634919 634964 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 634917 634918 . - . intron_id 11 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 547418 634918 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 547418 547419 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 547389 547417 . - . NIVO01055543.1 exonerate:protein2genome:local exon 547389 547417 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 547387 547388 . - . intron_id 12 ; splice_site "GA" NIVO01055543.1 exonerate:protein2genome:local intron 373665 547388 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 373665 373666 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 373640 373664 . - . NIVO01055543.1 exonerate:protein2genome:local exon 373640 373664 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 373638 373639 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 373639 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 268071 341633 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 268071 268072 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 268002 268070 . - . NIVO01055543.1 exonerate:protein2genome:local exon 268002 268070 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 268002 1229280 111 - . alignment_id 9 ; Query SPP00000005_1.0 ; Align 1229281 28 78 ; Align 1209545 54 24 ; Align 1197046 63 48 ; Align 1006636 79 24 ; Align 897699 88 18 ; Align 870397 95 9 ; Align 863845 99 6 ; Align 860402 101 15 ; Align 843741 107 12 ; Align 657991 112 36 ; Align 634964 125 45 ; Align 547418 140 27 ; Align 373664 150 24 ; Align 268071 158 69 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 114 Query range: 1 -> 185 Target range: 1127252 -> 303971 2 : AlaPheIleAla{Ly} >>>> Target Intron 1 >>>> {s}SerPheTy : 9 ||||||||| !{||} 160556 bp {|}... AlaPheIleGln{Ly}++ ++{s}Asp***Th 1127252 : GCATTTATACAA{AA}gt.........................ag{g}gattgaac : 966675 10 : rAspLeuSerAlaIleSerLeuAspGly{Gl} >>>> Target Intron 2 > : 19 ...:::|||...|||||| |||{..} 40161 bp rSerIleSerCysIleSerCysLeuGly{Se}++ 966674 : cagcatctcttgcatctcctgccttggc{ag}gt...................... : 966641 20 : >>> {u}LysValAspPheAsnThrPheArgGlyArgAlaValLeuIleGluAsn : 35 {.}|||:::|||||| .!! !!..! ! !:!!|||:!:|||..! +-{r}LysIleAspPheTyrCysIleTrpSerLeuLysMetLeuLeuGluGly 966640 : ...at{t}aaaattgatttttattgcaTCTGGTCTTTAAAGATGCTTTTGGAAGGC : 926436 36 : ValAlaSerLeuUnkGlyThrThr{Th} >>>> Target Intron 3 >>>> : 44 :!!:!! !! !....!!.!!|||{!:} 2153 bp IleSerVal***SerSerAlaThr{Se}++ + 926435 : ATTTCAGTATGAAGCAGTGCTACA{AG}gt.........................a : 924256 45 : {r}ArgAspPheThrGlnLeuAsnGluLeuGlnCysArgPhe >>>> Target : 58 {!} ! !|||! ! :::||||||||| !|||||| 24 +{r}AspCysPheLysGlyAlaHisGluLeuGlnSerArgPhe-+ 924255 : g{T}GATTGTTTCAAGggagcccatgaactgcaaagCAGATTTat........... : 924212 59 : Intron 4 >>>> ProArgArgLeuValValLeuGlyPhePro{C} >>>> : 68 180 bp |||||||||:!!||| ! !!.!! !{|} ++ProArgArgIleValLysAspAla***Glu{C}++ 924211 : ..............agCCAAGAAGAATTGTAAAAGATGCTTGAGAA{T}gt..... : 900001 69 : Target Intron 5 >>>> {ys}{A} >>>> Target Intron 6 >>>> : 69 20197 bp {||}{|} 18738 bp ++{ys}{A}++ 900000 : ....................ag{GT}{A}gt......................... : 879801 70 : {sn}GlnPheGlyHisGlnGlu >>>> Target Intron 7 >>>> Asn : 76 {||}:::||| ...:::::: 3226 bp ||| +-{sn}ArgPheLeuArgLysGln++ ++Asn 879800 : at{ac}agatttctcaggaagcaggt.........................agAAC : 857819 77 : CysGlnAsnGluGluIleLeuAsnSerLeuLys{T} >>>> Target Intron : 88 ||| ! |||||| ...... :::{ } 169225 bp Cys***TrpGluGluAlaLysGluLysThrGlu{A}++ 857818 : TGCTGATGGGAGGAAGccaaggaaaagacagaa{a}gt.................. : 857780 89 : 8 >>>> {yr}ValArgProGlyGlyGlyTyrGlnProThrPheThr{L} >> : 101 { }::::::||||||... ...|||.........{:} ++{rg}IleLysProGlySerLeuAlaSerProAlaLeuAla{V}++ 857779 : .......ag{gg}attaaacctggttctcttgcatctcctgcattggca{g}gt.. : 688516 102 : >> Target Intron 9 >>>> {eu}ValGlnLys >>>> Target Intr : 105 9876 bp {!!}:!!|||||| 5673 b ++{al}IleGlnLys++ 688515 : .......................ag{TG}ATCCAGAAGgt................ : 678629 106 : on 10 >>>> CysGluValAsnGly{G} >>>> Target Intron 11 >> : 110 p ||| !:!!|||{ } 125732 bp ++MetGluProAspGly{A}++ 678628 : ..........agATGGAGCCTGATGGG{G}gt........................ : 672940 111 : >> {ln}AsnGluHisProValPheAlaTyrLeuLysAsp{Ly} >>>> Targ : 122 { }!!...!|||||| !.!!:!!|||:::|||:::{||} ++{la}LysArgHisProSerIleSerTyrValLysGlu{Ly}+- 672939 : ..ag{CC}AAGAGGCATCCTTCTATCTCCTATGtgaaggaa{aa}ga......... : 547171 123 : et Intron 12 >>>> {s}LeuProTyrProTyrAspAspProPheSerLeuM : 134 77518 bp {|}||||||:::|||:::|||...||| ... ++{s}LeuProHisProTrpAspSerProGlyLysAsnT 547170 : .................ag{g}ctcccccatccctgggattctccaggcaagaaca : 469621 135 : etThr >>>> Target Intron 13 >>>> AspProLysLeuIleIleTrp : 142 5669 bp !!: !!:!!! !:!!|||||| hrGly++ ++GluThrGlnProValIleTrp 469620 : ctggagt..........................agGAAACACAACCAGTAAtctgg : 463928 143 : {Se} >>>> Target Intron 14 >>>> {r}ProValArgArgSerAspV : 150 {||} 83525 bp {|} !:!! !! !!!!!!: {Se}+- ++{r}AspMetGlySerThrGluL 463927 : {ag}ga..........................ag{T}GATATGGGGTCAACAGAGA : 380379 151 : alAlaTrpAsnPhe{Gl} >>>> Target Intron 15 >>>> {u}LysPh : 157 ! !|||:!!!::{..} 25604 bp {!}...!: ysArgTrpHisTyr{Ar}++ ++{g}SerTy 380378 : AGAGATGGCATTAc{ag}gt..........................ag{G}TCTTA : 354754 158 : eLeu >>>> Target Intron 16 >>>> >>>> Target Intron 1 : 159 !||| 4806 bp 8309 bp rLeu++ ++++ 354753 : TCTGgt..........................aggt.................... : 349940 160 : 7 >>>> >>>> Target Intron 18 >>>> IleGlyProGluGlyGlu : 164 664 bp :!!||||||||| !||| ++++ +-LeuGlyProGluProGlu 349939 : ......aggt..........................atCTTGGCCCTGAGCCTGAG : 340954 165 : Pro >>>> Target Intron 19 >>>> Phe{A} >>>> Target Int : 167 !! 24338 bp ...{!} 12579 Thr++ ++Ile{L}++ 340953 : ACAgt..........................agata{a}gt............... : 316604 168 : ron 20 >>>> {rg}ArgTyrSerArgThrPheProThrIleAsnIleGluPro : 180 bp {:!}||||||! ! !.!!||||||||| ! !:!:|||! ++{ys}ArgTyrIleLeuAlaPheProThrAlaAlaLeuGluGln 316603 : ...........ag{aA}CGTTATATATTGGCCTTCCCCACTGCCGCTTTGGAGCAg : 303989 181 : AspIleLysArgLeu : 185 :::::: ||| AlaLeuArgAlaLeu 303988 : gctctcagagctctc : 303972 vulgar: SPP00000005_1.0 1 185 . NIVO01055543.1 1127252 303971 - 114 M 4 12 S 0 2 5 0 2 I 0 160552 3 0 2 S 1 1 M 12 36 S 0 2 5 0 2 I 0 40157 3 0 2 S 1 1 M 24 72 S 0 2 5 0 2 I 0 2149 3 0 2 S 1 1 M 13 39 5 0 2 I 0 24176 3 0 2 M 10 30 S 0 1 5 0 2 I 0 20193 3 0 2 S 1 3 5 0 2 I 0 18734 3 0 2 S 1 2 M 6 18 5 0 2 I 0 3222 3 0 2 M 12 36 S 0 1 5 0 2 I 0 169221 3 0 2 S 1 2 M 12 36 S 0 1 5 0 2 I 0 9872 3 0 2 S 1 2 M 3 9 5 0 2 I 0 5669 3 0 2 M 5 15 S 0 1 5 0 2 I 0 125728 3 0 2 S 1 2 M 11 33 S 0 2 5 0 2 I 0 77514 3 0 2 S 1 1 M 13 39 5 0 2 I 0 5665 3 0 2 M 7 21 S 0 2 5 0 2 I 0 83521 3 0 2 S 1 1 M 11 33 S 0 2 5 0 2 I 0 25600 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 660 3 0 2 M 7 21 5 0 2 I 0 24334 3 0 2 M 1 3 S 0 1 5 0 2 I 0 12575 3 0 2 S 1 2 M 18 54 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 303972 1127252 114 - . gene_id 10 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1127239 1127252 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1127239 1127252 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1127237 1127238 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 966683 1127238 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 966683 966684 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 966644 966682 . - . NIVO01055543.1 exonerate:protein2genome:local exon 966644 966682 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 966642 966643 . - . intron_id 2 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 926483 966643 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 926483 926484 . - . intron_id 1 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 926408 926482 . - . NIVO01055543.1 exonerate:protein2genome:local exon 926408 926482 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 926406 926407 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 924255 926407 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 924255 924256 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 924215 924254 . - . NIVO01055543.1 exonerate:protein2genome:local exon 924215 924254 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 924213 924214 . - . intron_id 4 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 900035 924214 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 900035 900036 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 900004 900034 . - . NIVO01055543.1 exonerate:protein2genome:local exon 900004 900034 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 900002 900003 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 879807 900003 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 879807 879808 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 879804 879806 . - . NIVO01055543.1 exonerate:protein2genome:local exon 879804 879806 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 879802 879803 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 861066 879803 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 861066 861067 . - . intron_id 5 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 861046 861065 . - . NIVO01055543.1 exonerate:protein2genome:local exon 861046 861065 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 861044 861045 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 857820 861045 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 857820 857821 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 857783 857819 . - . NIVO01055543.1 exonerate:protein2genome:local exon 857783 857819 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 857781 857782 . - . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 688558 857782 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 688558 688559 . - . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 688519 688557 . - . NIVO01055543.1 exonerate:protein2genome:local exon 688519 688557 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 688517 688518 . - . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 678643 688518 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 678643 678644 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 678632 678642 . - . NIVO01055543.1 exonerate:protein2genome:local exon 678632 678642 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 678630 678631 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 672959 678631 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 672959 672960 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 672943 672958 . - . NIVO01055543.1 exonerate:protein2genome:local exon 672943 672958 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 672941 672942 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 547211 672942 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 547211 547212 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 547174 547210 . - . NIVO01055543.1 exonerate:protein2genome:local exon 547174 547210 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 547172 547173 . - . intron_id 12 ; splice_site "ga" NIVO01055543.1 exonerate:protein2genome:local intron 469656 547173 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 469656 469657 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 469616 469655 . - . NIVO01055543.1 exonerate:protein2genome:local exon 469616 469655 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 469614 469615 . - . intron_id 13 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 463947 469615 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 463947 463948 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 463924 463946 . - . NIVO01055543.1 exonerate:protein2genome:local exon 463924 463946 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 463922 463923 . - . intron_id 14 ; splice_site "ga" NIVO01055543.1 exonerate:protein2genome:local intron 380399 463923 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 380399 380400 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 380363 380398 . - . NIVO01055543.1 exonerate:protein2genome:local exon 380363 380398 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 380361 380362 . - . intron_id 15 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 354759 380362 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 16 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 340970 341633 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 340970 340971 . - . intron_id 17 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local cds 340949 340969 . - . NIVO01055543.1 exonerate:protein2genome:local exon 340949 340969 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 340947 340948 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 316611 340948 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 316611 316612 . - . intron_id 18 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 316607 316610 . - . NIVO01055543.1 exonerate:protein2genome:local exon 316607 316610 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 316605 316606 . - . intron_id 20 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 304028 316606 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 304028 304029 . - . intron_id 19 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 303972 304027 . - . NIVO01055543.1 exonerate:protein2genome:local exon 303972 304027 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 303972 1127252 114 - . alignment_id 10 ; Query SPP00000005_1.0 ; Align 1127253 2 12 ; Align 966682 7 36 ; Align 926482 20 72 ; Align 924254 45 39 ; Align 900035 58 30 ; Align 861064 70 18 ; Align 857820 76 36 ; Align 688556 89 36 ; Align 678641 102 9 ; Align 672959 105 15 ; Align 547209 111 33 ; Align 469655 123 39 ; Align 463947 136 21 ; Align 380398 144 33 ; Align 354758 156 9 ; Align 340970 159 21 ; Align 316611 166 3 ; Align 304026 168 54 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 112 Query range: 16 -> 171 Target range: 912849 -> 32694 17 : AspGlyGluLysValAspPheAsnThrPheArgGlyArgAlaValLeuIle{Gl} > : 34 !!:|||! !||| !||||||!..||||||!:!.!!!.!... ||| {.!} GluGlyAlaLysAsnAspPheArgThrPheGlnSerAsnThrGluLeuPro{As}++ 912849 : GAAGGAGCAAAAAATGATTTCAGAACCTTCCAGAGTAACacagagcttccc{aa}gt. : 912794 35 : >>> Target Intron 1 >>>> {u}AsnValAla{S} >>>> Target Int : 38 136695 bp {.}|||||||||{.} 96063 ++{n}AsnValAla{A}++ 912793 : ........................ag{C}AATGTAGCA{G}gt............... : 776088 39 : ron 2 >>>> {er}LeuUnk{G} >>>> Target Intron 3 >>>> {ly} : 41 bp {.!}:!!...{|} 40961 bp {||} ++{sp}ValAla{G}++ ++{ly} 776087 : ..........ag{AT}GTTGCT{G}gt.........................ag{gc} : 639057 42 : {Th} >>>> Target Intron 4 >>>> {r}ThrThrArgAspPheThr{Gl} : 49 {! } 6541 bp {!}!:!..!!:!|||.!.|||{::} {Ar}++ ++{g}SerValGlnAspLeuThr{Ar} 639056 : {ag}gt.........................ag{A}AGTGTTCAGGATCTGACC{AG} : 632493 50 : >>>> Target Intron 5 >>>> {n}LeuAsnGluLeu{G} >>>> Targ : 54 64789 bp {!}:!!::: |||{:} ++ ++{g}IleSerAlaLeu{G}++ 632492 : gt.........................ag{G}ATATcagctcta{g}gt......... : 567686 55 : et Intron 6 >>>> {ln}CysArgPheProArgArgLeuVal >>>> Targe : 63 27292 bp {!!}|||...||| !..!|||::: 7 ++{lu}CysAsnPheLysGluArgIleLys++ 567685 : ................ag{aa}tgtaactTTAAAGAGagaattaaggt.......... : 540368 64 : t Intron 7 >>>> ValLeuGlyPheProCys{As} >>>> Target Intro : 69 9371 bp :!! ! !||| !|||{!:} 93707 bp ++IleGlyProPheGlyCys{Se}++ 540367 : ...............agATAGGGCCCTTTGGTTGC{AG}gt................. : 460977 70 : n 8 >>>> {n}GlnPheGlyHisGlnGluAsnCysGlnAsnGluGluIleLeuAsn : 84 {!} :::||||||:::|||::: ...|||:::::: ++{r}ProTrpGlyHisLysGluSerAspThrThrGluGlnLeu***Val 460976 : ........ag{t}ccatggggtcacaaagagtcagacacaactgagcaactttaagta : 367229 85 : Ser{Le} >>>> Target Intron 9 >>>> {u}LysTyrVal >>>> Tar : 90 |||{ } 12463 bp {!}...|||:!! Ser{Ly}++ ++{s}SerTyrLeu++ 367228 : agt{aa}gt.........................ag{G}TCTTATCTGgt........ : 354746 91 : get Intron 10 >>>> >>>> Target Intron 11 >>>> >>>> T : 90 4806 bp 8309 bp ++++ ++++ 354745 : ..................aggt..........................aggt...... : 341631 91 : arget Intron 12 >>>> ArgPro{Gl} >>>> Target Intron 13 >> : 92 16913 bp !!|||{||} 48000 bp ++GlyPro{Gl}++ 341630 : ....................agGGTCCT{GG}gt........................ : 324710 93 : >> {y}GlyGlyTyrGlnProThrPheThrLeuValGlnLysCysGluVal{As} : 108 {|}|||...:::|||||| ::: ...||| {!.} ++{y}GlySerPheGlnProArgAsp***IleArgIleSerCysValGly{Ar}++ 324709 : ..ag{g}ggatctttccaacccagggattgaatccgcatctcctgtgttggc{ag}gt : 276664 109 : >>>> Target Intron 14 >>>> {n}GlyGln >>>> Target Intron : 111 9431 bp {.}|||||| 1495 bp ++{g}GlyGln-+ 276663 : ..........................ag{G}GGCCAGat................... : 267224 112 : 15 >>>> AsnGluHisProValPheAlaTyrLeuLysAspLysLeuProTyrProT : 127 :::..!:!! ! !!||| !|||:!!!!....::: ! !!|||! !| ++SerArgTyrLysPhePheAsnTyrIleAsnSerArgAsnSerTyrGlnT 267223 : .......agTCAAGATATAAGTTCTTTAATTATATTAACTCACGTAATTCATACCAAT : 265683 128 : yrAspAsp{Pr} >>>> Target Intron 16 >>>> {o}PheSer >>>> : 133 || { } 68137 bp {!}|||::! yrProIle{Se}++ ++{r}PheAsn++ 265682 : ACCctatc{ag}gt..........................ag{t}ttcaaTgt..... : 197526 134 : Target Intron 17 >>>> LeuMetThrAspProLysLeuIleIleTrpSerPr : 144 84097 bp :!! ! |||... !:!!:!: !||||| +-IleCysGlnProProSerSerLeuLeuLeuSerPr 197525 : .....................aaATTTGTCAGCCGCCCTCTAGCCTCCTGCTGTCACC : 113398 145 : oValArgArgSerAspValAlaTrp >>>> Target Intron 18 >>>> Asn : 153 | ! !!:!|||..!:!! !||| 31287 bp ||| oLysSerLysSerSerLeuIleTrp++ ++Asn 113397 : CAAATCCAAGTCATCTTTAATCTGGgt..........................agaat : 82084 154 : PheGluLysPheLeu >>>> Target Intron 19 >>>> IleGlyProGluG : 163 ||| :::|||::: 48644 bp ||| !|||:!!| PheProGlnPheVal++ +-IleLysProLysG 82083 : tttccacagtttgttgt..........................aaATTAAACCCAAAG : 33410 164 : lyGluProPhe{A} >>>> Target Intron 20 >>>> {rg}ArgTyrSerA : 171 ||||||||! {.} 689 bp {.!}||||||.!!| lyGluProSer{G}++ ++{lu}ArgTyrGlyA 33409 : GAGAACCTTCA{G}gt..........................ag{AG}CGGTATGGGC : 32697 172 : rg : 171 || rg 32696 : GT : 32695 vulgar: SPP00000005_1.0 16 171 . NIVO01055543.1 912849 32694 - 112 M 17 51 S 0 2 5 0 2 I 0 136691 3 0 2 S 1 1 M 3 9 S 0 1 5 0 2 I 0 96059 3 0 2 S 1 2 M 2 6 S 0 1 5 0 2 I 0 40957 3 0 2 S 1 4 5 0 2 I 0 6537 3 0 2 S 1 1 M 6 18 S 0 2 5 0 2 I 0 64785 3 0 2 S 1 1 M 4 12 S 0 1 5 0 2 I 0 27288 3 0 2 S 1 2 M 8 24 5 0 2 I 0 79367 3 0 2 M 6 18 S 0 2 5 0 2 I 0 93703 3 0 2 S 1 1 M 16 48 S 0 2 5 0 2 I 0 12459 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 16909 3 0 2 M 2 6 S 0 2 5 0 2 I 0 47996 3 0 2 S 1 1 M 15 45 S 0 2 5 0 2 I 0 9427 3 0 2 S 1 1 M 2 6 5 0 2 I 0 1491 3 0 2 M 19 57 S 0 2 5 0 2 I 0 68133 3 0 2 S 1 1 M 2 6 5 0 2 I 0 84093 3 0 2 M 20 60 5 0 2 I 0 31283 3 0 2 M 6 18 5 0 2 I 0 48640 3 0 2 M 8 24 S 0 1 5 0 2 I 0 685 3 0 2 S 1 2 M 4 12 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 32695 912849 112 - . gene_id 11 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 912797 912849 . - . NIVO01055543.1 exonerate:protein2genome:local exon 912797 912849 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 912795 912796 . - . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 776102 912796 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 776102 776103 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 776091 776101 . - . NIVO01055543.1 exonerate:protein2genome:local exon 776091 776101 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 776089 776090 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 680028 776090 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 680028 680029 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 680019 680027 . - . NIVO01055543.1 exonerate:protein2genome:local exon 680019 680027 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 680017 680018 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 639058 680018 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 639058 639059 . - . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 639054 639057 . - . NIVO01055543.1 exonerate:protein2genome:local exon 639054 639057 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 639052 639053 . - . intron_id 4 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 632513 639053 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 632513 632514 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 632492 632512 . - . NIVO01055543.1 exonerate:protein2genome:local exon 632492 632512 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 632490 632491 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 567703 632491 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 567703 567704 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 567689 567702 . - . NIVO01055543.1 exonerate:protein2genome:local exon 567689 567702 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 567687 567688 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 540397 567688 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 540397 540398 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 540371 540396 . - . NIVO01055543.1 exonerate:protein2genome:local exon 540371 540396 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 540369 540370 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 461000 540370 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 461000 461001 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 460980 460999 . - . NIVO01055543.1 exonerate:protein2genome:local exon 460980 460999 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 460978 460979 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 367273 460979 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 367273 367274 . - . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 367222 367272 . - . NIVO01055543.1 exonerate:protein2genome:local exon 367222 367272 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 367220 367221 . - . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 354759 367221 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 324721 341633 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 324721 324722 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 324713 324720 . - . NIVO01055543.1 exonerate:protein2genome:local exon 324713 324720 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 324711 324712 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 276713 324712 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 276713 276714 . - . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 276665 276712 . - . NIVO01055543.1 exonerate:protein2genome:local exon 276665 276712 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 276663 276664 . - . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 267234 276664 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 267234 267235 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 267227 267233 . - . NIVO01055543.1 exonerate:protein2genome:local exon 267227 267233 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 267225 267226 . - . intron_id 15 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 265732 267226 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 265732 265733 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 265673 265731 . - . NIVO01055543.1 exonerate:protein2genome:local exon 265673 265731 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 265671 265672 . - . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 197536 265672 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 197536 197537 . - . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 197529 197535 . - . NIVO01055543.1 exonerate:protein2genome:local exon 197529 197535 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 197527 197528 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 113432 197528 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 113432 113433 . - . intron_id 16 ; splice_site "AA" NIVO01055543.1 exonerate:protein2genome:local cds 113372 113431 . - . NIVO01055543.1 exonerate:protein2genome:local exon 113372 113431 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 113370 113371 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 82085 113371 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 82085 82086 . - . intron_id 17 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 82067 82084 . - . NIVO01055543.1 exonerate:protein2genome:local exon 82067 82084 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 82065 82066 . - . intron_id 19 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 33423 82066 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 33423 33424 . - . intron_id 18 ; splice_site "AA" NIVO01055543.1 exonerate:protein2genome:local cds 33398 33422 . - . NIVO01055543.1 exonerate:protein2genome:local exon 33398 33422 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 33396 33397 . - . intron_id 20 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 32709 33397 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 32709 32710 . - . intron_id 19 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 32695 32708 . - . NIVO01055543.1 exonerate:protein2genome:local exon 32695 32708 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 32695 912849 112 - . alignment_id 11 ; Query SPP00000005_1.0 ; Align 912850 17 51 ; Align 776101 35 9 ; Align 680026 39 6 ; Align 632512 43 18 ; Align 567702 50 12 ; Align 540395 55 24 ; Align 461000 63 18 ; Align 367272 70 48 ; Align 354758 87 9 ; Align 324721 90 6 ; Align 276712 93 45 ; Align 267233 109 6 ; Align 265732 111 57 ; Align 197535 131 6 ; Align 113432 133 60 ; Align 82085 153 18 ; Align 33423 159 24 ; Align 32707 168 12 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 109 Query range: 1 -> 113 Target range: 504275 -> 14873 2 : AlaPheIleAlaLysSerPheTyrAspLeuSer >>>> Target Intron 1 >> : 13 ...|||::: ||||||||| :::... 58510 bp GlyPheValIleTyrSerPheTyrTyrValGlu++ 504275 : gggtttgtcatatatagcttttattatgttgaggt....................... : 504240 14 : >> AlaIleSerLeuAspGlyGluLysValAspPheAsnThr >>>> Target I : 26 :!!:!:!!!|||! .!!||| !:!!!!: ... ! 4339 ++SerValThrLeuGlySerGluLeuLeuGluLysGlyGln++ 504239 : ..agTCTGTGACACTAGGGAGCGAGTTGCTGGAGAAAGGGCAGgt............. : 445691 27 : ntron 2 >>>> PheArgGly{Ar} >>>> Target Intron 3 >>>> {g : 29 5 bp ||| !..!{||} 47529 bp {| ++PhePheSer{Ar}++ ++{g 445690 : ............agTTTTTCTCA{AG}gt.........................ag{G : 354758 30 : }AlaValLeu >>>> Target Intron 4 >>>> >>>> Target Intro : 33 }:!! !||| 4806 bp 8309 bp }SerTyrLeu++ ++++ 354757 : }TCTTATCTGgt.........................aggt................. : 349940 34 : n 5 >>>> >>>> Target Intron 6 >>>> IleGluAsnValAlaSer{ : 39 10240 bp !:!!!.! ! !|||{ ++++ ++AlaLysThrLysHisSer{ 349939 : ........aggt.........................agGCAAAAACCAAGCACTCT{ : 331375 40 : Le} >>>> Target Intron 7 >>>> {u}UnkGlyThrThrThrArgAspPh : 47 ! } 55944 bp {!} ...::: |||||| Gl}++ ++{n}GlySerSerGlnProArgAspGl 331374 : CA}gt.........................ag{g}ggatcttcccaacccagggatca : 275407 48 : eThrGlnLeuAsnGluLeuGln{C} >>>> Target Intron 8 >>>> {ys} : 55 ||||||:::::: ::: { } 10925 bp {!!} nThrGlnIleSerCysIleAla{G}++ ++{ly} 275406 : aacccagatctcctgcattgca{g}gt.........................ag{GC} : 264457 56 : ArgPheProArgArgLeu{V} >>>> Target Intron 9 >>>> {al}ValL : 64 !:!|||! !|||||| !{|} 14993 bp {||} | LysPheLeuArgArgAla{V}++ ++{al}PheL 264456 : AAGTTTCTGAGGAGAGCA{G}gt.........................ag{ta}ttct : 249438 65 : euGlyPheProCysAsnGlnPhe{G} >>>> Target Intron 10 >>>> {l : 72 ||||||||||||||...... {|} 3158 bp {| euGlyPheProCysGlySerAsp{G}++ ++{l 249437 : tgggcttcccttgtggttcagat{g}gt..........................ag{g : 246255 73 : y} >>>> Target Intron 11 >>>> HisGlnGluAsnCysGlnAsnGluGl : 81 |} 43239 bp :!!.....!:!! ! !|||..!.! y}++ ++AsnSerArgHisValLeuAsnArgHi 246254 : a}gt..........................agAATAGCAGACATGTCTTAAACAGGCA : 202990 82 : uIleLeuAsn{S} >>>> Target Intron 12 >>>> {er}LeuLys >>> : 88 .:!! ! {:} 44823 bp {!!}! !||| sValLysAla{A}++ ++{la}TyrLys++ 202989 : TGTAAAGGCA{G}gt..........................ag{CA}TACAAGgt... : 158144 89 : > Target Intron 13 >>>> TyrValArgProGly{G} >>>> Target I : 93 20850 bp :!!|||! !|||{|} 117 +-ValIleArgLeuGly{G}++ 158143 : .......................aaGTAATCAGGCTGGGA{G}gt............. : 137278 94 : ntron 14 >>>> {ly}GlyTyrGlnPro{T} >>>> Target Intron 15 : 98 bp {||}|||:!!! |||{ } 122228 bp ++{ly}GlyHisLeuPro{A}++ 137277 : .............ag{GA}GGCCATCTTCCT{G}gt...................... : 137146 99 : >>>> {hr}PheThrLeuValGlnLysCysGluValAsnGlyGlnAsnGluHis : 113 { !}||| !:!! |||||| !!::!||| !......||| ++{sp}PheProSerLeuThrLysCysProPheSerGlyAlaGlySerHis 137145 : ....ag{at}ttccctaGTTTAACCAAATGTCCTTTTTCTGGTGCAGGATCTCAT : 14874 vulgar: SPP00000005_1.0 1 113 . NIVO01055543.1 504275 14873 - 109 M 11 33 5 0 2 I 0 58506 3 0 2 M 13 39 5 0 2 I 0 43391 3 0 2 M 3 9 S 0 2 5 0 2 I 0 47525 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 10236 3 0 2 M 6 18 S 0 2 5 0 2 I 0 55940 3 0 2 S 1 1 M 15 45 S 0 1 5 0 2 I 0 10921 3 0 2 S 1 2 M 6 18 S 0 1 5 0 2 I 0 14989 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 3154 3 0 2 S 1 2 5 0 2 I 0 43235 3 0 2 M 12 36 S 0 1 5 0 2 I 0 44819 3 0 2 S 1 2 M 2 6 5 0 2 I 0 20846 3 0 2 M 5 15 S 0 1 5 0 2 I 0 113 3 0 2 S 1 2 M 4 12 S 0 1 5 0 2 I 0 122224 3 0 2 S 1 2 M 15 45 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 14874 504275 109 - . gene_id 12 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 504243 504275 . - . NIVO01055543.1 exonerate:protein2genome:local exon 504243 504275 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 504241 504242 . - . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 445733 504242 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 445733 445734 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 445694 445732 . - . NIVO01055543.1 exonerate:protein2genome:local exon 445694 445732 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 445692 445693 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 402299 445693 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 402299 402300 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 402288 402298 . - . NIVO01055543.1 exonerate:protein2genome:local exon 402288 402298 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 402286 402287 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 402287 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 331394 341633 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 331394 331395 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 331374 331393 . - . NIVO01055543.1 exonerate:protein2genome:local exon 331374 331393 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 331372 331373 . - . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 275430 331373 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 275430 275431 . - . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 275383 275429 . - . NIVO01055543.1 exonerate:protein2genome:local exon 275383 275429 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 275381 275382 . - . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 264458 275382 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 264458 264459 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 264437 264457 . - . NIVO01055543.1 exonerate:protein2genome:local exon 264437 264457 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 264435 264436 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 249444 264436 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 249444 249445 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 249414 249443 . - . NIVO01055543.1 exonerate:protein2genome:local exon 249414 249443 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 249412 249413 . - . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 246256 249413 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 246256 246257 . - . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 246254 246255 . - . NIVO01055543.1 exonerate:protein2genome:local exon 246254 246255 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 246252 246253 . - . intron_id 11 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 203015 246253 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 203015 203016 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 202978 203014 . - . NIVO01055543.1 exonerate:protein2genome:local exon 202978 203014 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 202976 202977 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 158155 202977 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 158155 158156 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 158147 158154 . - . NIVO01055543.1 exonerate:protein2genome:local exon 158147 158154 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 158145 158146 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 137297 158146 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 137297 137298 . - . intron_id 12 ; splice_site "AA" NIVO01055543.1 exonerate:protein2genome:local cds 137281 137296 . - . NIVO01055543.1 exonerate:protein2genome:local exon 137281 137296 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 137279 137280 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 137164 137280 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 137164 137165 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 137149 137163 . - . NIVO01055543.1 exonerate:protein2genome:local exon 137149 137163 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 137147 137148 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 14921 137148 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 14921 14922 . - . intron_id 14 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 14874 14920 . - . NIVO01055543.1 exonerate:protein2genome:local exon 14874 14920 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 14874 504275 109 - . alignment_id 12 ; Query SPP00000005_1.0 ; Align 504276 2 33 ; Align 445733 13 39 ; Align 402299 26 9 ; Align 354758 30 9 ; Align 331394 33 18 ; Align 275429 40 45 ; Align 264456 56 18 ; Align 249442 63 27 ; Align 203015 73 36 ; Align 158153 86 6 ; Align 137297 88 15 ; Align 137162 94 12 ; Align 14919 99 45 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 106 Query range: 37 -> 186 Target range: 1209970 -> 70468 38 : SerLeuUnkGlyThrThrThr{Ar} >>>> Target Intron 1 >>>> {g : 45 ||||||... ||||||{||} 159282 bp {| SerLeuSerGlnTrpThrThr{Ar}++ ++{g 1209970 : agtcttagccagtggaccacc{ag}gt.........................ag{a : 1050665 46 : }AspPheThrGlnLeu{As} >>>> Target Intron 2 >>>> {n}GluL : 53 }||||||::: {!.} 109899 bp {.}.!. }AspPheSerGlyGly{Ar}++ ++{g}HisA 1050664 : }gatttctcaggaggc{ag}gt.........................ag{A}CATA : 940744 54 : euGlnCysArgPheProArgArgLeuValValLeuGlyPhe{P} >>>> Targe : 67 !:!!|||! !|||||||||||| |||...|||{ } 2 rgGluCysIlePheProArgArgHisPhePheLeuSerPhe{M}+- 940743 : GGGAGTGCATCTTTCCCAggagacatttctttctttctttc{a}ga.......... : 940699 68 : t Intron 3 >>>> {ro}CysAsnGlnPheGlyHisGlnGluAsn{C} >>> : 77 4390 bp { !} |||.!.||| ! !.!.:!!|||{|} ++{et}ThrAsnAspPheLysSerAsnGlnAsn{C}++ 940698 : ...............ag{TG}ACAAATGACTTCAAGTCCAACCAAAAT{T}gt... : 916279 78 : > Target Intron 4 >>>> {ys}{G} >>>> Target Intron 5 >> : 78 36475 bp {||}{:} 37305 bp ++{ys}{L}++ 916278 : ......................ag{GT}{A}gt....................... : 879801 79 : >> {ln}Asn{G} >>>> Target Intron 6 >>>> {lu}GluIleLeu : 83 {!!}.!.{!} 6664 bp { !}|||.!!:!! ++{ys}Glu{G}++ ++{ly}GluPheVal 879800 : ..ag{AA}GAA{G}gt.........................ag{GA}GAGTTTGTG : 835820 84 : AsnSerLeuLysTyrValArgPro >>>> Target Intron 7 >>>> Gly : 92 !..:!!:!!||| ! ! !||| 61324 bp ||| ThrAlaIleLysMetGlyLeuPro++ ++Gly 835819 : ACAGCTATTAAGATGGGATTACCTgt.........................agGGC : 774469 93 : GlyGlyTyrGlnPro{Th} >>>> Target Intron 8 >>>> {r}PheTh : 100 !..!:!!:!!|||{ } 158342 bp {!}||||| ***SerHisGluPro{As}++ ++{p}PheTh 774468 : TAGTCCCATGAGCCT{GA}gt.........................ag{C}TTCAC : 616103 101 : rLeuValGln{Ly} >>>> Target Intron 9 >>>> {s}CysGluVal{ : 108 |! !..!! !{!:} 119826 bp {!}|||!!:|||{ rCysThrPro{Ar}++ ++{g}CysAspVal{ 616102 : CTGCACCCCA{AG}gt.........................ag{g}tGTGATGTA{ : 496253 109 : As} >>>> Target Intron 10 >>>> {n}GlyGln >>>> Target : 111 !:} 84137 bp {!}...||| 223 Se}++ ++{r}SerGln++ 496252 : AG}gt..........................ag{t}agtcaggt............ : 412105 112 : Intron 11 >>>> AsnGluHisProValPheAlaTyrLeuLys{A} >>>> : 121 87 bp ! ! !! !:!! ! !!|||||||||{!} ++ValLeuSerGlnMetProProTyrLeuLys{G}++ 412104 : ..............agGTTTTGAGTCAAATGCCTCCTTATCTGAAA{G}gt..... : 389687 122 : Target Intron 12 >>>> {sp}LysLeuProTyrProTyrAspAspProPh : 131 31819 bp { } |||||| ||| |||.. ++{ly}AspLeuProAspProGlyIleLysProMe 389686 : .....................ag{gg}gatcttcccgacccagggatcaaacccat : 357841 132 : eSerLeuMetThrAspProLys >>>> Target Intron 13 >>>> >> : 139 .|||... ||| !! ! 7875 bp tSerPheThrThrProAlaLeu++ ++++ 357840 : gtcttttacaaCTCCGGCATTGgt..........................aggt.. : 349940 140 : >> Target Intron 14 >>>> LeuIleIleTrpSerProValArg{Ar} : 147 8283 bp :!!:!!::: ||||||::: {||} ++ValLeuLeuLeuSerProLeuSer{Ar}++ 349939 : ........................agGTATTAttactttctcctctttcc{ag}gt : 341633 148 : >>>> Target Intron 15 >>>> {g}SerAspValAlaTrpAsnPheGlu : 156 39163 bp {|}|||.!.||| !||||||!::||| ++{g}SerGlnVal***TrpAsnTrpGlu+ 341632 : ..........................ag{G}TCACAGGTCTAGTGGAACTGGGAAg : 302445 157 : >>>> Target Intron 16 >>>> Lys{Ph} >>>> Target Intron : 157 20487 bp |||{.!} 36933 bp + ++Lys{Le}++ 302444 : t..........................agAAA{CT}gt.................. : 281951 158 : 17 >>>> {e}LeuIleGlyPro{Gl} >>>> Target Intron 18 >>> : 162 {.}::: ||| {..} 174464 bp ++{u}IleSerGlySer{Se}++ 281950 : ........ag{g}atatctggctct{ag}gt......................... : 245003 163 : > {u}GlyGluProPheArgArgTyrSerArgThrPheProThrIleAsnIleGl : 179 {.}|||...|||.!!! !|||:!!!!!! !.!!! !|||:!! !!:!: ++{r}GlySerProLeuThrArgHisThrProAlaSerGlyThrValTyrLeuLe 245002 : .ag{T}GGCTCTCCACTCACCAGGCACACCCCTGCCTCAGGTACCGTATACTTGCT : 70492 180 : uProAspIleLysArgLeuLeu : 186 !||| !:!: |||:!!:!! uProPheLeuProArgMetIle 70491 : GCCTTTTCTGCCCAGAATGATT : 70469 vulgar: SPP00000005_1.0 37 186 . NIVO01055543.1 1209970 70468 - 106 M 7 21 S 0 2 5 0 2 I 0 159278 3 0 2 S 1 1 M 5 15 S 0 2 5 0 2 I 0 109895 3 0 2 S 1 1 M 15 45 S 0 1 5 0 2 I 0 24386 3 0 2 S 1 2 M 9 27 S 0 1 5 0 2 I 0 36471 3 0 2 S 1 3 5 0 2 I 0 37301 3 0 2 S 1 2 M 1 3 S 0 1 5 0 2 I 0 6660 3 0 2 S 1 2 M 11 33 5 0 2 I 0 61320 3 0 2 M 6 18 S 0 2 5 0 2 I 0 158338 3 0 2 S 1 1 M 5 15 S 0 2 5 0 2 I 0 119822 3 0 2 S 1 1 M 3 9 S 0 2 5 0 2 I 0 84133 3 0 2 S 1 1 M 2 6 5 0 2 I 0 22383 3 0 2 M 10 30 S 0 1 5 0 2 I 0 31815 3 0 2 S 1 2 M 17 51 5 0 2 I 0 7871 3 0 2 5 0 2 I 0 8279 3 0 2 M 8 24 S 0 2 5 0 2 I 0 39159 3 0 2 S 1 1 M 8 24 5 0 2 I 0 20483 3 0 2 M 1 3 S 0 2 5 0 2 I 0 36929 3 0 2 S 1 1 M 4 12 S 0 2 5 0 2 I 0 174460 3 0 2 S 1 1 M 24 72 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 70469 1209970 106 - . gene_id 13 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1209948 1209970 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1209948 1209970 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1209946 1209947 . - . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1050666 1209947 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1050666 1050667 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1050648 1050665 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1050648 1050665 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1050646 1050647 . - . intron_id 2 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 940749 1050647 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 940749 940750 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 940702 940748 . - . NIVO01055543.1 exonerate:protein2genome:local exon 940702 940748 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 940700 940701 . - . intron_id 3 ; splice_site "ga" NIVO01055543.1 exonerate:protein2genome:local intron 916312 940701 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 916312 916313 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 916282 916311 . - . NIVO01055543.1 exonerate:protein2genome:local exon 916282 916311 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 916280 916281 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 879807 916281 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 879807 879808 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 879804 879806 . - . NIVO01055543.1 exonerate:protein2genome:local exon 879804 879806 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 879802 879803 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 842499 879803 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 842499 842500 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 842493 842498 . - . NIVO01055543.1 exonerate:protein2genome:local exon 842493 842498 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 842491 842492 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 835829 842492 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 835829 835830 . - . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 835794 835828 . - . NIVO01055543.1 exonerate:protein2genome:local exon 835794 835828 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 835792 835793 . - . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 774470 835793 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 774470 774471 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 774450 774469 . - . NIVO01055543.1 exonerate:protein2genome:local exon 774450 774469 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 774448 774449 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 616108 774449 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 616108 616109 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 616090 616107 . - . NIVO01055543.1 exonerate:protein2genome:local exon 616090 616107 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 616088 616089 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 496264 616089 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 496264 496265 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 496252 496263 . - . NIVO01055543.1 exonerate:protein2genome:local exon 496252 496263 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 496250 496251 . - . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 412115 496251 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 412115 412116 . - . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 412108 412114 . - . NIVO01055543.1 exonerate:protein2genome:local exon 412108 412114 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 412106 412107 . - . intron_id 11 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 389721 412107 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 389721 389722 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 389690 389720 . - . NIVO01055543.1 exonerate:protein2genome:local exon 389690 389720 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 389688 389689 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 357871 389689 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 357871 357872 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 357818 357870 . - . NIVO01055543.1 exonerate:protein2genome:local exon 357818 357870 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 357816 357817 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 357817 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341660 349942 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 341660 341661 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 341634 341659 . - . NIVO01055543.1 exonerate:protein2genome:local exon 341634 341659 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 302471 341633 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 302471 302472 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 302446 302470 . - . NIVO01055543.1 exonerate:protein2genome:local exon 302446 302470 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 302444 302445 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 281959 302445 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 281959 281960 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 281954 281958 . - . NIVO01055543.1 exonerate:protein2genome:local exon 281954 281958 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 281952 281953 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 245021 281953 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 245021 245022 . - . intron_id 16 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 245006 245020 . - . NIVO01055543.1 exonerate:protein2genome:local exon 245006 245020 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 245004 245005 . - . intron_id 18 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 70542 245005 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 70542 70543 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 70469 70541 . - . NIVO01055543.1 exonerate:protein2genome:local exon 70469 70541 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 70469 1209970 106 - . alignment_id 13 ; Query SPP00000005_1.0 ; Align 1209971 38 21 ; Align 1050665 46 15 ; Align 940748 52 45 ; Align 916310 68 27 ; Align 842497 79 3 ; Align 835827 81 33 ; Align 774470 92 18 ; Align 616107 99 15 ; Align 496263 105 9 ; Align 412114 109 6 ; Align 389721 111 30 ; Align 357869 122 51 ; Align 341660 139 24 ; Align 302470 148 24 ; Align 281959 156 3 ; Align 245020 158 12 ; Align 70541 163 72 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 105 Query range: 3 -> 146 Target range: 1148137 -> 27730 4 : IleAlaLysSerPheTyrAspLeuSerAlaIle >>>> Target Intron 1 : 15 |||||||||||| !!:!:!!||||||::: 23338 bp IleAlaLysSerHisPheAsnLeuSerSerCys++ 1148137 : ATTGCTAAATCACATTTTAATCTaagcagttgtgt..................... : 1148102 16 : >>>> SerLeuAspGly{G} >>>> Target Intron 2 >>>> {lu}Ly : 20 ||||||||||||{|} 167377 bp {||}:! ++SerLeuAspGly{G}-+ ++{lu}Gl 1148101 : ....agAGCCTGGATGGT{G}ct.........................ag{AG}CA : 957374 21 : sValAspPheAsnThrPhe >>>> Target Intron 3 >>>> ArgGlyAr : 29 !|||||||||::! !||| 33951 bp ::: || nValAspPheSerGlyPhe++ ++Lys***Ar 957373 : GGTTGACTTTTCCGGTTTTgt.........................agaagtaaag : 923396 30 : gAlaValLeuIleGlu{A} >>>> Target Intron 4 >>>> {sn}ValA : 37 | ::: ||||||{.} 82161 bp {!.}:!!: gLysIleLysIleGlu{G}++ ++{lu}LeuS 923395 : gaaaattaaaatagag{g}gt.........................ag{AG}CTTT : 841211 38 : laSerLeuUnk{G} >>>> Target Intron 5 >>>> {ly}ThrThrThr : 44 !!|||||| {|} 42248 bp {||}.!! ! ! erSerLeuGly{G}++ ++{ly}AlaGlyPhe 841210 : CTTCTTTGGGG{G}gt.........................ag{GT}GCTGGATTC : 798942 45 : Arg{A} >>>> Target Intron 6 >>>> {sp}PheThr{Gl} >>>> : 49 !!{|} 29550 bp {||}||||||{::} ***{A}++ ++{sp}PheThr{Ar}++ 798941 : TGA{G}gt.........................ag{aC}TTTacc{ag}gt..... : 769373 50 : Target Intron 7 >>>> {n}LeuAsnGluLeuGlnCysArgPhePro{Ar} : 59 123929 bp {!}||||||...:!! !||| ! |||{ } +-{g}LeuAsnSerValThrCysAlaUnkPro{Le} 769372 : ....................at{A}CTCAATTCTGTCACATGTGCTANGCCC{TT} : 645418 60 : >>>> Target Intron 8 >>>> {g}ArgLeuValValLeuGlyPhePro : 67 80462 bp {!}! !:!!!..::: ||||||||| ++ ++{u}ThrIleAlaIleGlyGlyPhePro 645417 : gt.........................ag{g}ACAATTGcaattgggggcttccct : 564932 68 : CysAsnGlnPheGlyHisGlnGluAsnCysGlnAsnGluGluIle{L} >>>> T : 83 ...... ||| |||......|||... |||::::::{:} SerGlySerAspGlyLysGlnSerThrCysAsnAlaGluAspLeu{V}++ 564931 : agtggctcagatggtaaacaatccacctgcaatgcagaagacctg{g}gt...... : 564881 84 : arget Intron 9 >>>> {eu}AsnSerLeuLysTyr{V} >>>> Target : 89 7293 bp {!!}:!!|||!!! ! {!} 12 ++{al}HisSerPheProGln{G}++ 564880 : ...................ag{TG}CACAGTTTTCCCCAA{G}gt........... : 557570 90 : Intron 10 >>>> {al}ArgProGlyGlyGlyTyrGlnProThrPhe{T} : 100 7357 bp { !}::: ||||||||| ||| { } ++{lu}LysGlyGlyGlyGlyThrAlaProCys***{C}++ 557569 : ...............ag{aa}aaaggtggtggggggacagccccctgttaa{t}gt : 430182 101 : >>>> Target Intron 11 >>>> {hr}LeuVal{Gl} >>>> Target : 103 75424 bp { !}|||:!!{ } 804 ++{ys}LeuIle{Cy}++ 430181 : ..........................ag{GT}CTTATC{TG}gt............ : 354746 104 : Intron 12 >>>> {n}LysCysGluValAsnGly{Gl} >>>> Target I : 110 06 bp { }|||..!! ! !||| !{::} 5703 ++{s}LysAlaAlaAsnAsnLeu{Ar}++ 354745 : ..............ag{C}AAGGCTGCAAATAACCTC{AG}gt............. : 274319 111 : ntron 13 >>>> {n}AsnGluHisProValPheAlaTyr{Le} >>>> Tar : 119 6 bp {!}...:!!||||||:!!.!..!! {:!} ++{g}GlyLysHisProIleLeuThrPro{Il}++ 274318 : .............ag{A}GGGAAGCATCCAATTCTAACTCCA{AT}gt........ : 217256 120 : get Intron 14 >>>> {u}LysAspLysLeuProTyrProTyr{A} >>>> : 128 75242 bp {!}|||||||||||| !!||||||!! {!} ++{e}LysAspLysLeuThrTyrPro***{G}++ 217255 : ..................ag{a}aaggataagctCACTTACCCTTAA{G}gt.... : 141988 129 : Target Intron 15 >>>> {sp}AspProPheSer >>>> Target In : 133 81484 bp { !} !||||||||| 25017 ++{ly}ThrProPheSer++ 141987 : ......................ag{GC}ACCCCTTTctcagt.............. : 60490 134 : tron 16 >>>> LeuMetThrAspProLys{Le} >>>> Target Intron : 139 bp |||::: :::{ } 7703 bp ++ArgGluThrGluLysArg{Ar}++ 60489 : ............agagagaaacagaaaagcgC{AG}gt.................. : 35453 140 : 17 >>>> {u}IleIleTrpSerProValArg : 146 {!} !:!!|||||||||:!!||| -+{g}CysValTrpSerProLeuArg 35452 : ........cg{G}TGCGTCTGGTCTCCTCTCCGC : 27731 vulgar: SPP00000005_1.0 3 146 . NIVO01055543.1 1148137 27730 - 105 M 11 33 5 0 2 I 0 23334 3 0 2 M 4 12 S 0 1 5 0 2 I 0 167373 3 0 2 S 1 2 M 7 21 5 0 2 I 0 33947 3 0 2 M 8 24 S 0 1 5 0 2 I 0 82157 3 0 2 S 1 2 M 5 15 S 0 1 5 0 2 I 0 42244 3 0 2 S 1 2 M 4 12 S 0 1 5 0 2 I 0 29546 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 123925 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 80458 3 0 2 S 1 1 M 23 69 S 0 1 5 0 2 I 0 7289 3 0 2 S 1 2 M 5 15 S 0 1 5 0 2 I 0 127353 3 0 2 S 1 2 M 10 30 S 0 1 5 0 2 I 0 75420 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 80402 3 0 2 S 1 1 M 6 18 S 0 2 5 0 2 I 0 57032 3 0 2 S 1 1 M 8 24 S 0 2 5 0 2 I 0 75238 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 81480 3 0 2 S 1 2 M 4 12 5 0 2 I 0 25013 3 0 2 M 6 18 S 0 2 5 0 2 I 0 7699 3 0 2 S 1 1 M 7 21 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 27731 1148137 105 - . gene_id 14 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1148105 1148137 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1148105 1148137 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1148103 1148104 . - . intron_id 1 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1124767 1148104 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1124767 1124768 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1124754 1124766 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1124754 1124766 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1124752 1124753 . - . intron_id 2 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 957377 1124753 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 957377 957378 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 957354 957376 . - . NIVO01055543.1 exonerate:protein2genome:local exon 957354 957376 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 957352 957353 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 923403 957353 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 923403 923404 . - . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 923378 923402 . - . NIVO01055543.1 exonerate:protein2genome:local exon 923378 923402 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 923376 923377 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 841217 923377 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 841217 841218 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 841199 841216 . - . NIVO01055543.1 exonerate:protein2genome:local exon 841199 841216 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 841197 841198 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 798951 841198 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 798951 798952 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 798936 798950 . - . NIVO01055543.1 exonerate:protein2genome:local exon 798936 798950 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 798934 798935 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 769386 798935 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 769386 769387 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 769376 769385 . - . NIVO01055543.1 exonerate:protein2genome:local exon 769376 769385 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 769374 769375 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 645447 769375 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 645447 645448 . - . intron_id 6 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local cds 645417 645446 . - . NIVO01055543.1 exonerate:protein2genome:local exon 645417 645446 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 645415 645416 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 564955 645416 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 564955 564956 . - . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 564884 564954 . - . NIVO01055543.1 exonerate:protein2genome:local exon 564884 564954 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 564882 564883 . - . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 557591 564883 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 557591 557592 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 557573 557590 . - . NIVO01055543.1 exonerate:protein2genome:local exon 557573 557590 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 557571 557572 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 430216 557572 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 430216 430217 . - . intron_id 9 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 430183 430215 . - . NIVO01055543.1 exonerate:protein2genome:local exon 430183 430215 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 430181 430182 . - . intron_id 11 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 354759 430182 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 274343 354748 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 274343 274344 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 274322 274342 . - . NIVO01055543.1 exonerate:protein2genome:local exon 274322 274342 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 274320 274321 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 217286 274321 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 217286 217287 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 217259 217285 . - . NIVO01055543.1 exonerate:protein2genome:local exon 217259 217285 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 217257 217258 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 142017 217258 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 142017 142018 . - . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 141991 142016 . - . NIVO01055543.1 exonerate:protein2genome:local exon 141991 142016 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 141989 141990 . - . intron_id 15 ; splice_site "Gt" NIVO01055543.1 exonerate:protein2genome:local intron 60507 141990 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 60507 60508 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 60493 60506 . - . NIVO01055543.1 exonerate:protein2genome:local exon 60493 60506 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 60491 60492 . - . intron_id 16 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 35476 60492 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 35476 35477 . - . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 35456 35475 . - . NIVO01055543.1 exonerate:protein2genome:local exon 35456 35475 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 35454 35455 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 27753 35455 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 27753 27754 . - . intron_id 16 ; splice_site "CG" NIVO01055543.1 exonerate:protein2genome:local cds 27731 27752 . - . NIVO01055543.1 exonerate:protein2genome:local exon 27731 27752 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 27731 1148137 105 - . alignment_id 14 ; Query SPP00000005_1.0 ; Align 1148138 4 33 ; Align 1124767 15 12 ; Align 957375 20 21 ; Align 923403 27 24 ; Align 841215 36 15 ; Align 798949 42 12 ; Align 769384 47 6 ; Align 645446 50 27 ; Align 564954 60 69 ; Align 557589 84 15 ; Align 430214 90 30 ; Align 354757 101 6 ; Align 274342 104 18 ; Align 217285 111 24 ; Align 142016 120 24 ; Align 60505 129 12 ; Align 35476 133 18 ; Align 27752 140 21 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 104 Query range: 0 -> 179 Target range: 845509 -> 100093 1 : MetAlaPheIleAlaLysSerPhe{T} >>>> Target Intron 1 >>>> {y : 9 |||||||||:!! !!:! ! {!} 31350 bp {: MetAlaPheValLysArgHisThr{T}++ ++{r 845509 : ATGGCGTTTGTCAAAAGACACACG{T}gt.........................ag{g : 814134 10 : r}AspLeuSerAlaIle >>>> Target Intron 2 >>>> SerLeuAspGly : 18 :}||||||:::::: 15167 bp !||||||..! p}AspLeuAlaSerGln+- ++ValLeuAspSer 814133 : g}gatcttgccagccaggg.........................agGTGCTGGATTCT : 798941 19 : Glu >>>> Target Intron 3 >>>> LysVal{A} >>>> Target Int : 22 ||| 12350 bp |||:!!{|} 17193 Glu++ ++LysLeu{A}++ 798940 : GAGgt.........................agAAGCTA{G}gt............... : 786576 23 : ron 4 >>>> {sp}PheAsn{Th} >>>> Target Intron 5 >>>> {r} : 25 bp {||}|||...{! } 161935 bp {!} ++{sp}PheThr{Ar}++ ++{g} 786575 : ..........ag{aC}TTTacc{ag}gt.........................ag{g} : 607440 26 : PheArgGlyArgAlaValLeuIleGluAsnValAlaSerLeuUnkGlyThrThrThrA : 45 ||| ||| :::...|||...... |||||| ||| |||. Phe***GlyIleSerThrLeuPheSerIleValAlaValLeuValCysProLeuThrA 607439 : ttttaaggaatctccacactgttctccatagtggctgtactagtttgccctctcacca : 607382 46 : rgAsp >>>> Target Intron 6 >>>> PheThrGlnLeuAsn{G} >>>> : 52 .. 126782 bp ||| |||:::{:} snArg++ ++PheProPheLeuSer{L}++ 607381 : acagggt.........................agtttccttttctctca{a}gt.... : 480576 53 : Target Intron 7 >>>> {lu}LeuGlnCysArgPheProArgArgLeuVal : 63 87288 bp {!!}|||:::|||:::||||||!.!!:! !:!! +-{ys}LeuLysCysLysPheProAsnGlnGluLeu+ 480575 : .....................aa{aa}ttaaaatgcaaatttccaAATCAGGAGCTGg : 393258 64 : >>>> Target Intron 8 >>>> ValLeuGly{P} >>>> Target Intr : 66 38500 bp ||||||..!{ } 56736 b + ++ValLeuSer{V}++ 393257 : t.........................agGTCTTATCT{G}gt................ : 354746 67 : on 9 >>>> {he}ProCysAsnGlnPheGlyHisGln{Gl} >>>> Target I : 75 p {!!} |||||||||!::|||!!.::!{ } 1602 ++{al}CysCysAsnGlnTrpGlyGlnArg{Il}++ 354745 : .........ag{tt}tgttgtaatcagTGGGGTCAGAGG{AT}gt............. : 297982 76 : ntron 10 >>>> {u}AsnCys{Gl} >>>> Target Intron 11 >>>> : 78 6 bp {!}||||||{:!} 29277 bp ++{e}AsnCys{Ly}++ ++ 297981 : .............ag{A}AACTGT{AA}gt..........................ag : 252674 79 : {n}AsnGluGluIleLeuAsnSerLeuLysTyrValArg{Pr} >>>> Target I : 91 {!}...!!: :!!||||||! !:!!! |||:!! !{ } 392 {s}GlyAspThrValLeuAsnLeuValIleTyrIleSer{Se}++ 252673 : {a}gGGGACACTGTCCTGAATTTGGTGATTTACATTTCC{AG}gt............. : 252631 92 : ntron 12 >>>> {o}GlyGlyGlyTyr >>>> Target Intron 13 >>>> : 96 9 bp {!} !!||||||:!! 31908 bp ++{r}CysGlyGlyHis++ 252630 : .............ag{T}TGTGGAGGCCACgt.......................... : 248689 97 : GlnProThrPheThrLeuValGlnLysCysGluValAsnGlyGlnAsnGluHisPr : 114 :!!||||||!:!||| !::: ::: ::: :::...|||... +-GluProThrTyrThrSerLeuProArgIleGlyLysSerThrGluThrGluArgLy 248688 : atGAGCCCACTTATACAAGCttacctagaataggcaaatctacagagacagaaagaaa : 216729 115 : o >>>> Target Intron 14 >>>> ValPheAlaTyrLeuLysAspLysLeu : 123 8909 bp !.!!::||| ! !!:! ! ..!:!! s++ -+AlaTrpAlaGlnThrArgLysSerVal 216728 : ggt..........................tgGCATGGGCTCAAACAAGGAAATCAGTC : 207793 124 : ProTyrProTyrAspAspProPheSerLeuMetThrAspProLysLeuIleIleTrp{ : 143 |||! !!:!:!! ||| ..!|||:!!|||.!.! ! ! !:!: !! { ProLeuGluPheAsnLeuProArgGlnLeuLeuThrGlnGlnLeuGlyValAla***{ 207792 : CCTTTAGAATTTAATTTGCCAAGGCAACTGCTGACCCAACAGTTGGGTGTGGCGTGA{ : 207733 144 : Se} >>>> Target Intron 15 >>>> {r}ProValArgArgSerAspValA : 151 ||} 6639 bp {|}||| !|||! !!!!.!.:!!: Se}++ -+{r}ProGlnArgThrCysGlnLeuS 207732 : AG}gt..........................tg{t}cCCCAAAGAACCTGTCAACTGT : 201070 152 : laTrpAsnPheGluLysPheLeuIleGlyProGluGly >>>> Target Intron : 164 !!|||!.. ..!|||! |||!!: ! !.!. ! 100890 bp erTrpArgArgArgLys***LeuMetIleMetAsnPro++ 201069 : CCTGGAGGAGACGGAAATAGCTCATGATAATGAACCCGgt.................. : 201029 165 : 16 >>>> GluProPheArgArgTyrSerArgThrPheProThrIleAsnIleGlu : 179 ! !! ! ..! ! ! ..!|||||||||||||||:!!.!.! !:!! ++AlaLeuLysGluAlaLysGlnArgThrPheProThrValGluThrGln 201028 : ........agGCACTGAAAGAAGCCAAGCAGAGGACTTTTCCCACGGTAGAAACTCAA : 100096 vulgar: SPP00000005_1.0 0 179 . NIVO01055543.1 845509 100093 - 104 M 8 24 S 0 1 5 0 2 I 0 31346 3 0 2 S 1 2 M 5 15 5 0 2 I 0 15163 3 0 2 M 5 15 5 0 2 I 0 12346 3 0 2 M 2 6 S 0 1 5 0 2 I 0 17189 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 161931 3 0 2 S 1 1 M 21 63 5 0 2 I 0 126778 3 0 2 M 5 15 S 0 1 5 0 2 I 0 87284 3 0 2 S 1 2 M 10 30 5 0 2 I 0 38496 3 0 2 M 3 9 S 0 1 5 0 2 I 0 56732 3 0 2 S 1 2 M 8 24 S 0 2 5 0 2 I 0 16022 3 0 2 S 1 1 M 2 6 S 0 2 5 0 2 I 0 29273 3 0 2 S 1 1 M 12 36 S 0 2 5 0 2 I 0 3925 3 0 2 S 1 1 M 4 12 5 0 2 I 0 31904 3 0 2 M 19 57 5 0 2 I 0 8905 3 0 2 M 28 84 S 0 2 5 0 2 I 0 6635 3 0 2 S 1 1 M 20 60 5 0 2 I 0 100886 3 0 2 M 16 48 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 100094 845509 104 - . gene_id 15 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 845485 845509 . - . NIVO01055543.1 exonerate:protein2genome:local exon 845485 845509 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 845483 845484 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 814135 845484 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 814135 814136 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 814118 814134 . - . NIVO01055543.1 exonerate:protein2genome:local exon 814118 814134 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 814116 814117 . - . intron_id 2 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 798951 814117 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 798951 798952 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 798936 798950 . - . NIVO01055543.1 exonerate:protein2genome:local exon 798936 798950 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 798934 798935 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 786586 798935 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 786586 786587 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 786579 786585 . - . NIVO01055543.1 exonerate:protein2genome:local exon 786579 786585 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 786577 786578 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 769386 786578 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 769386 769387 . - . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 769376 769385 . - . NIVO01055543.1 exonerate:protein2genome:local exon 769376 769385 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 769374 769375 . - . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 607441 769375 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 607441 607442 . - . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 607377 607440 . - . NIVO01055543.1 exonerate:protein2genome:local exon 607377 607440 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 607375 607376 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 480595 607376 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 480595 480596 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 480579 480594 . - . NIVO01055543.1 exonerate:protein2genome:local exon 480579 480594 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 480577 480578 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 393291 480578 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 393291 393292 . - . intron_id 6 ; splice_site "aa" NIVO01055543.1 exonerate:protein2genome:local cds 393259 393290 . - . NIVO01055543.1 exonerate:protein2genome:local exon 393259 393290 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 393257 393258 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 393258 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 298013 354748 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 298013 298014 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 297985 298012 . - . NIVO01055543.1 exonerate:protein2genome:local exon 297985 298012 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 297983 297984 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 281959 297984 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 281959 281960 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 281950 281958 . - . NIVO01055543.1 exonerate:protein2genome:local exon 281950 281958 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 281948 281949 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 252673 281949 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 252673 252674 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 252634 252672 . - . NIVO01055543.1 exonerate:protein2genome:local exon 252634 252672 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 252632 252633 . - . intron_id 12 ; splice_site "Gt" NIVO01055543.1 exonerate:protein2genome:local intron 248705 252633 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 248705 248706 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 248692 248704 . - . NIVO01055543.1 exonerate:protein2genome:local exon 248692 248704 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 248690 248691 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 216784 248691 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 216784 216785 . - . intron_id 12 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local cds 216727 216783 . - . NIVO01055543.1 exonerate:protein2genome:local exon 216727 216783 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 216725 216726 . - . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 207818 216726 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 207818 207819 . - . intron_id 13 ; splice_site "TG" NIVO01055543.1 exonerate:protein2genome:local cds 207732 207817 . - . NIVO01055543.1 exonerate:protein2genome:local exon 207732 207817 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 207730 207731 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 201093 207731 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 201093 201094 . - . intron_id 14 ; splice_site "tg" NIVO01055543.1 exonerate:protein2genome:local cds 201032 201092 . - . NIVO01055543.1 exonerate:protein2genome:local exon 201032 201092 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 201030 201031 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 100142 201031 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 100142 100143 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 100094 100141 . - . NIVO01055543.1 exonerate:protein2genome:local exon 100094 100141 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 100094 845509 104 - . alignment_id 15 ; Query SPP00000005_1.0 ; Align 845510 1 24 ; Align 814133 10 15 ; Align 798951 15 15 ; Align 786586 20 6 ; Align 769384 23 6 ; Align 607440 26 63 ; Align 480595 47 15 ; Align 393289 53 30 ; Align 354759 63 9 ; Align 298011 67 24 ; Align 281958 76 6 ; Align 252672 79 36 ; Align 248704 92 12 ; Align 216784 96 57 ; Align 207818 115 84 ; Align 201092 144 60 ; Align 100142 164 48 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 101 Query range: 10 -> 185 Target range: 1218178 -> 93593 11 : LeuSerAlaIleSerLeuAspGlyGluLysValAspPhe{As} >>>> Target : 24 !!!|||:!!|||! !||| !||| !!||| !|||.!!{!.} 19 PheSerSerIlePheLeuThrGly***LysCysAspLeu{Ar}-+ 1218178 : TTTAGTTCTATTTTCTTAACTGGCTAGAAGTGTGATCTT{AG}tt........... : 1218135 25 : Intron 1 >>>> {n}ThrPheArgGlyArgAlaValLeuIleGluAsnValA : 37 596 bp {.}||| |||...:::...::!! !.!!:!! !.!: ++{g}ThrValArgAsnLysCysLeuTrpPheLysProAlaS 1218134 : ..............ag{a}acagtgagaaataaatgcctGTGGTTTAAGCCAGCCA : 1198504 38 : laSer{Le} >>>> Target Intron 2 >>>> {u}UnkGlyThrThrThr : 44 :! !{! } 63428 bp {!} ...::: erLeu{Tr}++ ++{p}GlySerSerGlnPro 1198503 : GTCTC{TG}gt.........................ag{g}ggatcttcccaaccc : 1135055 45 : ArgAspPheThrGlnLeuAsnGluLeuGlnCysArgPheProArg{Ar} >>>> : 60 |||||| ||||||::::::...::: ||| {||} ArgAspGlnThrGlnValSerHisIleAlaGlyValPheLeuThr{Ar}-+ 1135054 : agggatcaaacccaggtctcccacattgcaggagtattcttgacc{ag}ct..... : 1135003 61 : Target Intron 3 >>>> {g}LeuValVal{L} >>>> Target Intro : 64 10727 bp {|}|||||||||{!} 9945 bp ++{g}LeuValVal{T}++ 1135002 : ....................ag{G}TTGgttgta{t}gt................. : 1124265 65 : n 4 >>>> {eu}GlyPheProCysAsnGlnPheGlyHisGln{G} >>>> Ta : 75 { !}...|||||| :::|||||| ...{|} ++{rp}SerPheProMetSerGlnPhePheAlaSer{G}++ 1124264 : ........ag{gg}tcttttccgatgagtcagttctttgcatca{g}gt....... : 1114287 76 : rget Intron 5 >>>> {lu}AsnCysGlnAsnGluGluIleLeuAsnSerLe : 86 67540 bp {||}||| !:!!||| :!!:!!|||:!!!!! ++{lu}AsnLeuGluAsnPheGlnLeuLeuAspThrTh 1114286 : ..................ag{AA}AATCTTGAAAACTTTCAGCTTTTAGACACTAC : 1046717 87 : uLys{Ty} >>>> Target Intron 6 >>>> {r}ValArgProGlyGlyG : 94 ! !{! } 75938 bp { } |||... | rLeu{Le}++ ++{u}GlySerProAsnProG 1046716 : TCTA{TT}gt.........................ag{g}ggatctcccaacccag : 970755 95 : lyTyrGlnPro{Th} >>>> Target Intron 7 >>>> {r}PheThrLeu : 101 || :::|||{!:} 8564 bp {!}.!!|||:!! lyIleGluPro{Se}++ ++{r}IleThrMet 970754 : ggattgaaccc{ag}gt.........................ag{C}ATCACCATG : 962170 102 : ValGlnLysCysGluVal >>>> Target Intron 8 >>>> AsnGly > : 110 ||| ||||||...:!! 27632 bp ||| ! ValPheLysCysSerIle-+ ++AsnThr++ 962169 : GTATTTAAATGCTCTATTtt.........................agaatacAgt. : 934509 111 : >>> Target Intron 9 >>>> GlnAsnGluHisProVal{Ph} >>>> T : 116 7842 bp :!!:!! :!!||| !!{.!} ++GluHisPheTyrProPhe{Il}++ 934508 : ........................agGAGCACTTTTATCCCTTC{AT}gt...... : 926647 117 : arget Intron 10 >>>> {e}AlaTyrLeuLysAspLysLeuProTyrProT : 127 67000 bp {.}::! !! !..!..!:!! ! !! !| ++{e}SerMetArgThrSerSerIleIleIleHisT 926646 : ....................ag{A}AGTATGAGAACATCTTCAATCATTATTCACT : 859618 128 : yrAspAspPro{P} >>>> Target Intron 11 >>>> {he}SerLeuMe : 134 |||||||||||{ } 29964 bp {! }!!!|||!! yrAspAspPro{V}-+ ++{al}ThrLeuIl 859617 : ATGATGATCCA{G}tt..........................ag{TG}ACACTTAT : 829633 135 : tThrAspProLysLeuIleIleTrpSerPro >>>> Target Intron 12 > : 145 :|||..! !! |||! ||||||!!! ! 5713 bp eThrSerAspIleLeuArgIleTrpArgGlu++ 829632 : CACTTCTGACATCCTAAGGATTTGGAGGGAGgt....................... : 829598 146 : >>> ValArgArg >>>> Target Intron 13 >>>> SerAspValAla : 151 ||||||!.! 151006 bp ||| ! :!!! ! ++ValArgAsn++ ++Ser***IleGlu 829597 : ...aggtgaGGAATgt..........................agTCTTAGATAGAA : 672863 152 : TrpAsnPhe{G} >>>> Target Intron 14 >>>> {lu}LysPheLeuI : 159 |||:!!|||{|} 40338 bp {||} !||| !| TrpAspPhe{G}-+ ++{lu}ValPheArgI 672862 : TGGGATTTT{G}ct..........................ag{AA}GTGTTCAGGA : 632501 160 : leGlyPro{G} >>>> Target Intron 15 >>>> {lu}{G} >>>> T : 163 || !!|||{|} 148870 bp {||}{|} le***Pro{G}++ ++{lu}{G}++ 632500 : TCTGACCA{G}gt..........................ag{AG}{G}gt...... : 483616 164 : arget Intron 16 >>>> {ly}GluPro{Ph} >>>> Target Intron : 166 128860 bp {||} !{!:} 13089 bp ++{ly}LeuIle{Tr}++ 483615 : ....................ag{GT}CTTATC{TG}gt.................. : 354746 167 : 17 >>>> {e}ArgArgTyrSerArgThrPhePro{T} >>>> Target In : 175 {:} ! ||| ||||||{.} 19562 ++{p}TyrTyrTyrPheLeuLeuPhePro{A}++ 354745 : ........ag{G}TATTAttactttctcctctttcca{g}gt.............. : 341631 176 : tron 18 >>>> {hr}IleAsnIle >>>> Target Intron 19 >>>> : 179 7 bp {!!}:!:|||!!: 52381 bp ++{la}LeuAsnMet++ + 341630 : ............ag{CG}CTGAACATGgt..........................a : 93616 180 : GluProAspIleLysArgLeu : 185 ||| ! ! !!:||||||:!! +GluArgLysMetLysArgIle 93615 : ggaaagGAAGATGAAGAGAATT : 93594 vulgar: SPP00000005_1.0 10 185 . NIVO01055543.1 1218178 93593 - 101 M 13 39 S 0 2 5 0 2 I 0 19592 3 0 2 S 1 1 M 14 42 S 0 2 5 0 2 I 0 63424 3 0 2 S 1 1 M 20 60 S 0 2 5 0 2 I 0 10723 3 0 2 S 1 1 M 3 9 S 0 1 5 0 2 I 0 9941 3 0 2 S 1 2 M 10 30 S 0 1 5 0 2 I 0 67536 3 0 2 S 1 2 M 12 36 S 0 2 5 0 2 I 0 75934 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 8560 3 0 2 S 1 1 M 9 27 5 0 2 I 0 27628 3 0 2 M 2 6 5 0 2 I 0 7838 3 0 2 M 6 18 S 0 2 5 0 2 I 0 66996 3 0 2 S 1 1 M 14 42 S 0 1 5 0 2 I 0 29960 3 0 2 S 1 2 M 13 39 5 0 2 I 0 5709 3 0 2 M 3 9 5 0 2 I 0 151002 3 0 2 M 7 21 S 0 1 5 0 2 I 0 40334 3 0 2 S 1 2 M 6 18 S 0 1 5 0 2 I 0 148866 3 0 2 S 1 3 5 0 2 I 0 128856 3 0 2 S 1 2 M 2 6 S 0 2 5 0 2 I 0 13085 3 0 2 S 1 1 M 8 24 S 0 1 5 0 2 I 0 195623 3 0 2 S 1 2 M 3 9 5 0 2 I 0 52377 3 0 2 M 7 21 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 93594 1218178 101 - . gene_id 16 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1218138 1218178 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1218138 1218178 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1218136 1218137 . - . intron_id 1 ; splice_site "TT" NIVO01055543.1 exonerate:protein2genome:local intron 1198542 1218137 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1198542 1198543 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1198497 1198541 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1198497 1198541 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1198495 1198496 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1135069 1198496 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1135069 1135070 . - . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1135006 1135068 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1135006 1135068 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1135004 1135005 . - . intron_id 3 ; splice_site "ct" NIVO01055543.1 exonerate:protein2genome:local intron 1124279 1135005 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1124279 1124280 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1124268 1124278 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1124268 1124278 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1124266 1124267 . - . intron_id 4 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1114323 1124267 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 1114323 1114324 . - . intron_id 3 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1114290 1114322 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1114290 1114322 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1114288 1114289 . - . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1046750 1114289 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 1046750 1046751 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1046710 1046749 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1046710 1046749 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1046708 1046709 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 970772 1046709 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 970772 970773 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 970742 970771 . - . NIVO01055543.1 exonerate:protein2genome:local exon 970742 970771 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 970740 970741 . - . intron_id 7 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 962178 970741 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 962178 962179 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 962150 962177 . - . NIVO01055543.1 exonerate:protein2genome:local exon 962150 962177 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 962148 962149 . - . intron_id 8 ; splice_site "TT" NIVO01055543.1 exonerate:protein2genome:local intron 934518 962149 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 934518 934519 . - . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 934512 934517 . - . NIVO01055543.1 exonerate:protein2genome:local exon 934512 934517 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 934510 934511 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 926670 934511 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 926670 926671 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 926650 926669 . - . NIVO01055543.1 exonerate:protein2genome:local exon 926650 926669 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 926648 926649 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 859650 926649 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 859650 859651 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 859606 859649 . - . NIVO01055543.1 exonerate:protein2genome:local exon 859606 859649 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 859604 859605 . - . intron_id 11 ; splice_site "TT" NIVO01055543.1 exonerate:protein2genome:local intron 829642 859605 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 829642 829643 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 829601 829641 . - . NIVO01055543.1 exonerate:protein2genome:local exon 829601 829641 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 829599 829600 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 823888 829600 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 823888 823889 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 823879 823887 . - . NIVO01055543.1 exonerate:protein2genome:local exon 823879 823887 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 823877 823878 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 672873 823878 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 672873 672874 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 672851 672872 . - . NIVO01055543.1 exonerate:protein2genome:local exon 672851 672872 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 672849 672850 . - . intron_id 14 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 632513 672850 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 632513 632514 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 632492 632512 . - . NIVO01055543.1 exonerate:protein2genome:local exon 632492 632512 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 632490 632491 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 483622 632491 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 483622 483623 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 483619 483621 . - . NIVO01055543.1 exonerate:protein2genome:local exon 483619 483621 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 483617 483618 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 483618 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341660 354748 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 341660 341661 . - . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 341634 341659 . - . NIVO01055543.1 exonerate:protein2genome:local exon 341634 341659 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 146007 341633 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 146007 146008 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 145996 146006 . - . NIVO01055543.1 exonerate:protein2genome:local exon 145996 146006 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 145994 145995 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 93615 145995 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 93615 93616 . - . intron_id 18 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 93594 93614 . - . NIVO01055543.1 exonerate:protein2genome:local exon 93594 93614 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 93594 1218178 101 - . alignment_id 16 ; Query SPP00000005_1.0 ; Align 1218179 11 39 ; Align 1198541 25 42 ; Align 1135068 40 60 ; Align 1124278 61 9 ; Align 1114321 65 30 ; Align 1046748 76 36 ; Align 970771 89 27 ; Align 962177 99 27 ; Align 934518 108 6 ; Align 926670 110 18 ; Align 859649 117 42 ; Align 829640 132 39 ; Align 823888 145 9 ; Align 672873 148 21 ; Align 632511 156 18 ; Align 354757 164 6 ; Align 341659 167 24 ; Align 146005 176 9 ; Align 93615 179 21 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 100 Query range: 0 -> 190 Target range: 1208223 -> 270756 1 : MetAlaPheIleAlaLysSerPheTyrAspLeuSerAlaIleSerLeuAspGlyGl : 19 |||:::...::::::|||:::...||| ...:::|||::!|||:!! MetSerIleLeuSerLysAlaIleTyrArgPheAsnAlaLeuSerIleArgLeuPr 1208223 : atgagtatattatccaaagcaatctatagattcaatgcactATCTATCAggctacc : 1208169 20 : uLysValAspPheAsnThrPheArgGly >>>> Target Intron 1 >>>> : 29 ... |||... ...... 10991 bp oMetAlaPhePheThrGluLeuGluGln-+ + 1208168 : aatggcatttttcacagaactagaacaaat.........................a : 1197150 30 : ArgAlaValLeuIleGluAsnValAlaSerLeuUnkGlyThrThrThrArgAsp : 47 ||| |||::::::||| :::::: ||| ...||| +IleAlaGlnLeuValLysAsnProProAlaMetGlnGluThrProValArgPhe+ 1197149 : gatagctcagttggtaaagaatccacctgcaatgcaggagaccccggttcgatttg : 1197094 48 : >>>> Target Intron 2 >>>> PheThrGlnLeuAsnGluLeuGlnCysA : 56 57254 bp |||:!!..!||||||.!.||| ! !! + ++PheSerMetLeuAsnAsnLeuTyrLeuH 1197093 : t.........................agTTTTCTATGTTGAACAATCTATATCTCC : 1139813 57 : rgPhePro<->ArgArgLeuValValLeuGly{Ph} >>>> Target Intron : 66 .!!:!||| !:!|||! !:!!:!!||| !{!:} 52914 bp isTyrProPheLysArgHisIleIleLeuGln{Tr}++ 1139812 : ACTACCCCTTTAAAAGGCACATAATACTGCAG{TG}gt.................. : 1139776 67 : 3 >>>> {e}ProCysAsnGlnPheGlyHisGlnGluAsnCysGlnAsnGlu{G : 81 {:}||| .!..!!! ! !:! :!!|||::!||| !{| ++{p}Pro***LeuAspIleValLeuArgIleAspCysArgAsnThr{G 1139775 : .......ag{g}ccctaGCTGGATATTGTGTTGCGGATTGATTGTAGAAATACA{G : 1086821 82 : } >>>> Target Intron 4 >>>> {lu}IleLeuAsnSerLeuLysTyr : 89 } 16621 bp {||}||||||::!! !|||!!. }++ ++{lu}IleLeuSerMetLeuAsnVal+ 1086820 : }gt.........................ag{AA}ATTCTTTCCATGTTGAATGTGg : 1070176 90 : >>>> Target Intron 5 >>>> ValArgProGlyGlyGlyTyrGlnProT : 98 18215 bp |||!:!|||.!! ! !!!:! ||| + ++ValLysProSerMetCysPheValProA 1070175 : t.........................agGTCAAGCCCAGCATGTGTTTTGTCCCAC : 1051934 99 : hrPheThrLeuValGln >>>> Target Intron 6 >>>> LysCysGluV : 107 !|||||| ! !! !! 13231 bp ||||||:!!| rgPheThrAspPhe***++ ++LysCysLysV 1051933 : GTTTCACTGACTTCTAAgt.........................agAAATGTAAGG : 1038676 108 : alAsnGlyGlnAsn{G} >>>> Target Intron 7 >>>> {lu}HisPro : 114 || ! !||| {|} 2039 bp {||}|||||| alAlaPheGln***{G}++ ++{lu}HisPro 1038675 : TTGCCTTTCAATGA{G}gt.........................ag{AG}CATCCT : 1036616 115 : ValPhe{Al} >>>> Target Intron 8 >>>> {a}TyrLeuLysAspLy : 122 ||||||{ } 81561 bp {!}::: :: ValPhe{Le}-+ ++{u}TrpGlnProThrAr 1036615 : GTTTTT{TT}ct.........................ag{a}tggcagcccaccag : 955031 123 : sLeuProTyrProTyrAspAspProPheSerLeuMetThr >>>> Target In : 136 :||||||:::|||:::|||...||| ... 37554 gLeuProHisProTrpAspSerProGlyLysAsnThrArg++ 955030 : gctccctcatccctgggattctccaggcaagaacactagagt.............. : 954987 137 : tron 9 >>>> AspProLys >>>> Target Intron 10 >>>> LeuI : 140 bp |||||| 16685 bp |||: ++GlyProLys++ ++LeuV 954986 : ...........agggtccaaaagt..........................agTTAG : 900738 141 : leIleTrpSerProValArgArgSerAsp >>>> Target Intron 11 >>> : 150 !!||||||.!! !!:!!!:!||| !!!: 20902 bp alIleTrpGlySerIleGlnArgValGlu++ 900737 : TAATATGGGGATCAATACAGAGAGTGGAGgt......................... : 900706 151 : > Val >>>> Target Intron 12 >>>> AlaTrpAsnPheGlu{L} : 156 ||| 2424 bp ::!|||!..!:: {|} ++Val++ ++SerTrpArgTrpLeu{L}++ 900705 : .agGTAgt..........................agAGTTGGAGATGGcta{a}gt : 877363 157 : >>>> Target Intron 13 >>>> {ys}PheLeuIleGlyProGluGlyGlu : 164 19544 bp {||}.!.|||!!:||| !... ++{ys}LeuLeuMetGlyGlySerGlnGly 877362 : ..........................ag{AA}CTGCTGATGGGAGGAAGccaagga : 857796 165 : ProPheArg{Ar} >>>> Target Intron 14 >>>> {g}TyrSer{A} : 171 |||{!:} 56186 bp {!}|||!!!{!} LysAspArg{Ly}++ ++{s}TyrThr{L}+ 857795 : aaagacaga{aa}gt..........................ag{G}TATACT{A}g : 801588 172 : >>>> Target Intron 15 >>>> {rg}ThrPheProThrIleAsnIleGl : 179 149562 bp {:!}!:!!!.||| !! !!:! !|| + ++{ys}SerLeuProTrpThrSerTyrGl 801587 : t..........................ag{AA}AGTTTGCCTTGGACTAGCTATGA : 652003 180 : uProAspIleLys >>>> Target Intron 16 >>>> Arg >>>> Tar : 185 |||| !:!:||| 168367 bp ||| uProProLeuLys++ ++Arg++ 652002 : ACCTCCTTTGAAGgt..........................agAGGgt........ : 483616 186 : get Intron 17 >>>> LeuLeuLys{V} >>>> Target Intron 18 : 188 128860 bp :!!|||...{|} 409 bp ++ValLeuSer{V}++ 483615 : ..................agGTCTTATCT{G}gt...................... : 354746 189 : >>>> {al} >>>> Target Intron 19 >>>> >>>> Target In : 189 {||} 4395 bp 8309 ++{al}++ ++++ 354745 : ....ag{TG}gt..........................aggt.............. : 349940 190 : tron 20 >>>> >>>> Target Intron 21 >>>> AlaIle : 190 bp 70871 bp |||||| ++++ ++AlaIle 349939 : ............aggt..........................aggcgatc : 270757 vulgar: SPP00000005_1.0 0 190 . NIVO01055543.1 1208223 270756 - 100 M 28 84 5 0 2 I 0 10987 3 0 2 M 18 54 5 0 2 I 0 57250 3 0 2 M 12 36 G 0 3 M 7 21 S 0 2 5 0 2 I 0 52910 3 0 2 S 1 1 M 14 42 S 0 1 5 0 2 I 0 16617 3 0 2 S 1 2 M 7 21 5 0 2 I 0 18211 3 0 2 M 15 45 5 0 2 I 0 13227 3 0 2 M 8 24 S 0 1 5 0 2 I 0 2035 3 0 2 S 1 2 M 4 12 S 0 2 5 0 2 I 0 81557 3 0 2 S 1 1 M 18 54 5 0 2 I 0 37550 3 0 2 M 3 9 5 0 2 I 0 16681 3 0 2 M 11 33 5 0 2 I 0 20898 3 0 2 M 1 3 5 0 2 I 0 2420 3 0 2 M 5 15 S 0 1 5 0 2 I 0 19540 3 0 2 S 1 2 M 11 33 S 0 2 5 0 2 I 0 56182 3 0 2 S 1 1 M 2 6 S 0 1 5 0 2 I 0 149558 3 0 2 S 1 2 M 12 36 5 0 2 I 0 168363 3 0 2 M 1 3 5 0 2 I 0 128856 3 0 2 M 3 9 S 0 1 5 0 2 I 0 405 3 0 2 S 1 2 5 0 2 I 0 4391 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 70867 3 0 2 M 2 6 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 270757 1208223 100 - . gene_id 17 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1208140 1208223 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1208140 1208223 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1208138 1208139 . - . intron_id 1 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local intron 1197149 1208139 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1197149 1197150 . - . intron_id 0 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1197095 1197148 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1197095 1197148 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1197093 1197094 . - . intron_id 2 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1139841 1197094 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1139841 1139842 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1139779 1139840 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1139779 1139840 . - . insertions 3 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1139777 1139778 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1086865 1139778 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1086865 1086866 . - . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1086821 1086864 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1086821 1086864 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1086819 1086820 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1070200 1086820 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 1070200 1070201 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1070177 1070199 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1070177 1070199 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1070175 1070176 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1051962 1070176 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 1051962 1051963 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1051917 1051961 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1051917 1051961 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1051915 1051916 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1038686 1051916 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 1038686 1038687 . - . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1038661 1038685 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1038661 1038685 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1038659 1038660 . - . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1036622 1038660 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 1036622 1036623 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1036606 1036621 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1036606 1036621 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1036604 1036605 . - . intron_id 8 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 955045 1036605 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 955045 955046 . - . intron_id 7 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 954990 955044 . - . NIVO01055543.1 exonerate:protein2genome:local exon 954990 955044 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 954988 954989 . - . intron_id 9 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 917436 954989 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 917436 917437 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 917427 917435 . - . NIVO01055543.1 exonerate:protein2genome:local exon 917427 917435 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 917425 917426 . - . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 900742 917426 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 900742 900743 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 900709 900741 . - . NIVO01055543.1 exonerate:protein2genome:local exon 900709 900741 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 900707 900708 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 879807 900708 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 879807 879808 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 879804 879806 . - . NIVO01055543.1 exonerate:protein2genome:local exon 879804 879806 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 879802 879803 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 877380 879803 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 877380 877381 . - . intron_id 11 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 877364 877379 . - . NIVO01055543.1 exonerate:protein2genome:local exon 877364 877379 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 877362 877363 . - . intron_id 13 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 857820 877363 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 857820 857821 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 857783 857819 . - . NIVO01055543.1 exonerate:protein2genome:local exon 857783 857819 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 857781 857782 . - . intron_id 14 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 801597 857782 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 801597 801598 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 801589 801596 . - . NIVO01055543.1 exonerate:protein2genome:local exon 801589 801596 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 801587 801588 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 652027 801588 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 652027 652028 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 651989 652026 . - . NIVO01055543.1 exonerate:protein2genome:local exon 651989 652026 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 651987 651988 . - . intron_id 16 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 483622 651988 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 483622 483623 . - . intron_id 15 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 483619 483621 . - . NIVO01055543.1 exonerate:protein2genome:local exon 483619 483621 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 483617 483618 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 483618 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 18 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354340 354748 . - . intron_id 18 NIVO01055543.1 exonerate:protein2genome:local splice3 354340 354341 . - . intron_id 17 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354338 354339 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354338 354339 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354336 354337 . - . intron_id 19 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354337 . - . intron_id 19 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 18 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 20 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 20 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 19 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 21 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 270763 341633 . - . intron_id 21 NIVO01055543.1 exonerate:protein2genome:local splice3 270763 270764 . - . intron_id 20 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 270757 270762 . - . NIVO01055543.1 exonerate:protein2genome:local exon 270757 270762 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 270757 1208223 100 - . alignment_id 17 ; Query SPP00000005_1.0 ; Align 1208224 1 84 ; Align 1197149 29 54 ; Align 1139841 47 36 ; Align 1139802 59 21 ; Align 1086864 67 42 ; Align 1070198 82 21 ; Align 1051962 89 45 ; Align 1038686 104 24 ; Align 1036620 113 12 ; Align 955044 118 54 ; Align 917436 136 9 ; Align 900742 139 33 ; Align 879807 150 3 ; Align 877380 151 15 ; Align 857818 157 33 ; Align 801596 169 6 ; Align 652025 172 36 ; Align 483622 184 3 ; Align 354759 185 9 ; Align 270763 189 6 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 100 Query range: 14 -> 181 Target range: 1223915 -> 13025 15 : SerLeuAspGlyGluLysValAspPheAsnThrPheArgGlyArgAlaValLeu{I : 33 ||||||:!!||||||||| !..! !!:!:!!.!!! !|||!:! ! !|||{: SerLeuAsnGlyGluLysSerSerAsnSerSerIleIleGlyLysIleCysLeu{V 1223915 : AGTCTAAATGGAGAAAAAAGTAGTAATAGTTCCATTATCGGAAAAATATGCCTA{G : 1223861 34 : } >>>> Target Intron 1 >>>> {le}GluAsnValAlaSerLeuUnkG : 41 } 92026 bp {!!}!!:!.! ! !|||:!! | }++ ++{al}AspThrAsn***SerValAspG 1223860 : }gt.........................ag{TT}GACACCAATTAGTCAGTTGATG : 1131811 42 : lyThrThrThrArg{A} >>>> Target Intron 2 >>>> {sp}PheThr : 48 ||! !|||:!!..!{!} 52366 bp { !}|||::: lyArgThrSerGlu{G}++ ++{ly}PheSer 1131810 : GCAGGACATCAGAG{G}gt.........................ag{gc}ttctct : 1079424 49 : GlnLeuAsnGluLeuGlnCysArgPhePro{Ar} >>>> Target Intron 3 : 59 |||... ||||||...|||... {..} 44177 bp ValLeuGlyIleLeuGlnAlaArgIleLeu{Gl}++ 1079423 : gtccttggaattctccaggcaagaatacta{ga}gt.................... : 1079387 60 : >>>> {g}ArgLeuValValLeuGlyPheProCys{As} >>>> Target I : 69 {!}|||:::::: |||||| !|||..!{! } 9397 ++{u}ArgIleLeuTyrLeuGlyAsnProAla{Me}++ 1079386 : .....ag{g}cgtattctttaccttGGAAACCCAGCC{AT}gt............. : 1035180 70 : ntron 4 >>>> {n}GlnPheGlyHisGlnGluAsnCysGlnAsnGluGluIle : 82 9 bp { }:::|||......||||||:::|||...::: ... +-{t}GluPheSerArgGlnGluHisCysSerAspLeuProPhe 1035179 : ............at{g}gaattctccaggcaagaacactgtagtgacttgccattt : 941166 83 : LeuAsnSerLeuLysTyrValArgPro{G} >>>> Target Intron 5 >>> : 92 ::: ... ...|||{|} 110480 bp ProSerProArgAsnLeuProGluPro{G}++ 941165 : ccttctccaaggaatcttcccgagcca{g}gt........................ : 941133 93 : > {ly}GlyGlyTyrGlnProThrPheThr >>>> Target Intron 6 >> : 101 {||} |||:::...|||||| 74006 bp ++{ly}***GlyPheSerProThrArgLeu++ 941132 : .ag{gt}taagggttcagtcccacaagactggt....................... : 830627 102 : >> LeuValGlnLysCys{Gl} >>>> Target Intron 7 >>>> {u}V : 107 ! ! !...!..|||{..} 183366 bp {!}: ++***TyrSerSerCys{Ar}++ ++{g}M 830626 : ..agTGATACAGCAGCTGC{AG}gt.........................ag{g}a : 573239 108 : alAsnGlyGln{As} >>>> Target Intron 8 >>>> {n}GluHisPro : 114 :::::|||...{!:} 199114 bp {!} ! !||| etSerGlySer{Se}++ ++{r}ProProPro 573238 : tgtctggctct{ag}gt.........................ag{T}CCCCCTCCT : 374104 115 : ValPheAlaTyrLeuLysAspLysLeuProTyrProTyrAspAsp{Pr} >>>> : 130 |||.!. !!! ||| .!.!:!||| ! ||||||! !!:{ } ValLeuProLeuLeuPheGlnArgLeuArgThrProTyrValGlu{Ly}++ 374103 : GTCCTACCCTTACTCTTCCAAAGATTAAGAACACCTTATGTAGAG{AA}gt..... : 374052 131 : Target Intron 9 >>>> {o}PheSerLeu >>>> Target Intron 1 : 134 19296 bp {!}! !! !||| 4806 bp ++{s}SerTyrLeu++ 374051 : ....................ag{G}TCTTATCTGgt.................... : 354746 135 : 0 >>>> >>>> Target Intron 11 >>>> >>>> Target Intr : 134 8309 bp 64939 b ++++ ++++ 354745 : ......aggt..........................aggt................ : 341631 135 : on 12 >>>> MetThrAspProLysLeuIleIleTrpSer >>>> Target : 144 p :::||| |||::: |||... 137 ++GlyLeuAsnProHisLeuLeuCysTrpGln++ 341630 : ..........agggattgaatccgcatctcctgtgttggcaggt............ : 276662 145 : Intron 13 >>>> ProValArgArgSerAspVal{A} >>>> Target In : 151 67 bp :::::!|||||| :!!{|} 10472 ++GlyIleLysArgSerMetLeu{A}++ 276661 : ..............aggggatcaaGCGATCAATGTTA{G}gt.............. : 262873 152 : tron 14 >>>> {la}TrpAsn >>>> Target Intron 15 >>>> Ph : 154 1 bp {||}!::!!. 653 bp || ++{la}TyrLys++ ++Ph 262872 : ............ag{CA}TACAAGgt..........................agTT : 157493 155 : eGluLysPheLeuIleGlyProGlu >>>> Target Intron 16 >>>> G : 163 |.!.!...!!||| !||||||:!! 121991 bp eHisSerLeuLeuSerGlyProLys-+ ++A 157492 : CCACAGCCTCCTCTCTGGTCCCAAAat..........................aga : 35475 164 : lyGluProPheArgArg{Ty} >>>> Target Intron 17 >>>> {r}Se : 170 ||| :::|||{ } 22393 bp { }|| rgGluThrGluLysArg{Ar}++ ++{g}Se 35474 : gagaaacagaaaagcgC{AG}gt..........................ag{G}AG : 13061 171 : rArgThrPheProThrIleAsnIleGluProAsp : 181 | !! !|||||| !:!!|||! ! |||||| rPheMetPheProGlyLeuAsnLysCysProAsp 13060 : TTTTATGTTTCCTGGACTTAACAAATGTCCAGAC : 13026 vulgar: SPP00000005_1.0 14 181 . NIVO01055543.1 1223915 13025 - 100 M 18 54 S 0 1 5 0 2 I 0 92022 3 0 2 S 1 2 M 12 36 S 0 1 5 0 2 I 0 52362 3 0 2 S 1 2 M 12 36 S 0 2 5 0 2 I 0 44173 3 0 2 S 1 1 M 9 27 S 0 2 5 0 2 I 0 93975 3 0 2 S 1 1 M 22 66 S 0 1 5 0 2 I 0 110476 3 0 2 S 1 2 M 8 24 5 0 2 I 0 74002 3 0 2 M 5 15 S 0 2 5 0 2 I 0 183362 3 0 2 S 1 1 M 4 12 S 0 2 5 0 2 I 0 199110 3 0 2 S 1 1 M 18 54 S 0 2 5 0 2 I 0 19292 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 64935 3 0 2 M 10 30 5 0 2 I 0 13763 3 0 2 M 7 21 S 0 1 5 0 2 I 0 104717 3 0 2 S 1 2 M 2 6 5 0 2 I 0 649 3 0 2 M 9 27 5 0 2 I 0 121987 3 0 2 M 6 18 S 0 2 5 0 2 I 0 22389 3 0 2 S 1 1 M 12 36 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 13026 1223915 100 - . gene_id 18 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1223861 1223915 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1223861 1223915 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1223859 1223860 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1131835 1223860 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1131835 1131836 . - . intron_id 0 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 1131796 1131834 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1131796 1131834 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1131794 1131795 . - . intron_id 2 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1079430 1131795 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 1079430 1079431 . - . intron_id 1 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1079390 1079429 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1079390 1079429 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1079388 1079389 . - . intron_id 3 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 1035213 1079389 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 1035213 1035214 . - . intron_id 2 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 1035183 1035212 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1035183 1035212 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1035181 1035182 . - . intron_id 4 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 941204 1035182 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 941204 941205 . - . intron_id 3 ; splice_site "at" NIVO01055543.1 exonerate:protein2genome:local cds 941136 941203 . - . NIVO01055543.1 exonerate:protein2genome:local exon 941136 941203 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 941134 941135 . - . intron_id 5 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 830656 941135 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 830656 830657 . - . intron_id 4 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 830630 830655 . - . NIVO01055543.1 exonerate:protein2genome:local exon 830630 830655 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 830628 830629 . - . intron_id 6 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 756624 830629 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 756624 756625 . - . intron_id 5 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 756607 756623 . - . NIVO01055543.1 exonerate:protein2genome:local exon 756607 756623 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 756605 756606 . - . intron_id 7 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 573241 756606 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 573241 573242 . - . intron_id 6 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 573226 573240 . - . NIVO01055543.1 exonerate:protein2genome:local exon 573226 573240 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 573224 573225 . - . intron_id 8 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 374112 573225 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 374112 374113 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 374055 374111 . - . NIVO01055543.1 exonerate:protein2genome:local exon 374055 374111 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 374053 374054 . - . intron_id 9 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 354759 374054 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 8 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 10 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 10 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 276695 341633 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 276695 276696 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 276665 276694 . - . NIVO01055543.1 exonerate:protein2genome:local exon 276665 276694 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 276663 276664 . - . intron_id 13 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 262898 276664 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 262898 262899 . - . intron_id 12 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 262876 262897 . - . NIVO01055543.1 exonerate:protein2genome:local exon 262876 262897 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 262874 262875 . - . intron_id 14 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 158155 262875 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 158155 158156 . - . intron_id 13 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 158147 158154 . - . NIVO01055543.1 exonerate:protein2genome:local exon 158147 158154 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 158145 158146 . - . intron_id 15 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 157494 158146 . - . intron_id 15 NIVO01055543.1 exonerate:protein2genome:local splice3 157494 157495 . - . intron_id 14 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 157467 157493 . - . NIVO01055543.1 exonerate:protein2genome:local exon 157467 157493 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 157465 157466 . - . intron_id 16 ; splice_site "AT" NIVO01055543.1 exonerate:protein2genome:local intron 35476 157466 . - . intron_id 16 NIVO01055543.1 exonerate:protein2genome:local splice3 35476 35477 . - . intron_id 15 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 35456 35475 . - . NIVO01055543.1 exonerate:protein2genome:local exon 35456 35475 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 35454 35455 . - . intron_id 17 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 13063 35455 . - . intron_id 17 NIVO01055543.1 exonerate:protein2genome:local splice3 13063 13064 . - . intron_id 16 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 13026 13062 . - . NIVO01055543.1 exonerate:protein2genome:local exon 13026 13062 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 13026 1223915 100 - . alignment_id 18 ; Query SPP00000005_1.0 ; Align 1223916 15 54 ; Align 1131833 34 36 ; Align 1079428 47 36 ; Align 1035212 60 27 ; Align 941203 70 66 ; Align 830654 93 24 ; Align 756624 101 15 ; Align 573240 107 12 ; Align 374111 112 54 ; Align 354758 131 9 ; Align 276695 134 30 ; Align 262898 144 21 ; Align 158153 152 6 ; Align 157494 154 27 ; Align 35476 163 18 ; Align 13062 170 36 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: SPP00000005_1.0 # Protein # Glutathione peroxidase 2 (GPx2) # Homo sapiens # Complete Target: NIVO01055543.1 Ammotragus lervia isolate NAZ scaffold118_len1248428_cov71, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 103 Query range: 14 -> 182 Target range: 1200706 -> 275393 15 : SerLeuAspGlyGluLysValAspPheAsnThrPheArgGlyArgAlaValLeuIl : 33 |||||| :::|||::: !::: !||||||..!! !||||||! !! SerLeuLysGlnGlnLysLeuThrProSerGlnPheArgAsnProAlaValGlnAs 1200706 : agcttaaaacaacagaaattaactccCTCACAGTTCAGGAATCCAGCTGTCCAAAA : 1200652 34 : eGluAsnValAlaSer >>>> Target Intron 1 >>>> LeuUnkGlyTh : 42 !:!!!:!:!!::!!!! 175497 bp ||| ..!:! nGlnSerIleSerArg++ -+LeuTyrAsnSe 1200651 : TCAAAGTATCAGCAGGgt.........................tgTTGTATAATTC : 1025128 43 : rThrThrArgAspPheThrGlnLeuAsnGluLeuGlnCysArgPheProArgArgL : 61 !! ! !|||..!! .!!:!! !||||||! !...! !! !|||! ! !!:!: rLysPheArgSer***AlaGluGluAsnGluProSerPheProPheGlnAlaLysI 1025127 : TAAGTTTAGAAGTTAAGCTGAAGAGAATGAACCTAGTTTTCCTTTCCAGGCAAAGA : 1025071 62 : euValValLeuGlyPheProCys{As} >>>> Target Intron 2 >>>> : 69 !!:!!..!||||||||| ! !{||} 150612 bp leLeuThrLeuGlyPhe***Asn{As}-+ ++ 1025070 : TTCTAACTTTGGGATTTTGAAAC{AA}ct.........................ag : 874435 70 : {n}GlnPheGlyHisGlnGluAsnCysGlnAsnGluGluIleLeuAsn{S} >>> : 85 {|}||||||!.! !:!!.!.|||! :!!..! :!!!..{|} {n}GlnPheAlaSerThrGlnGluCysLeuHisSerPheTrpIleArg{S}++ 874434 : {C}CAGTTTGCATCAACACAAGAGTGTCTTCACTCATTTTGGATAAGA{T}gt... : 874384 86 : > Target Intron 3 >>>> {er}LeuLysTyr{Va} >>>> Target I : 89 5691 bp {||}!!!||||||{:!} 2618 ++{er}PheLysTyr{Il}-+ 874383 : ......................ag{CT}TTTAAATAT{AT}ct............. : 868680 90 : ntron 4 >>>> {l}ArgProGlyGlyGlyTyrGlnProThrPheThrLeuVal : 102 4 bp {!}||| ! !||| ! ! ! !|||:!! !:!! ++{e}ArgArgTyrGlyLysAlaIleAsnAspPheSerThrLeu 868679 : ............ag{A}AGAAGGTATGGAAAGGCTATTAATGATTTTTCAACTTTA : 842461 103 : GlnLysCysGlu >>>> Target Intron 5 >>>> ValAsnGlyGlnAsn : 111 ||| !|||||| 66250 bp ||||||..!.!. ! Gln***CysGlu++ ++ValAsnAsnAsnAla 842460 : CAATGATGTGAAgt.........................agGTAAATAATAATGCC : 776184 112 : GluHisProValPheAlaTyrLeu >>>> Target Intron 6 >>>> Lys : 120 ! ||| !..!||| !||| ! 136043 bp ::: TyrHis***ThrPheAsnTyrLys++ ++Glu 776183 : TATCATTGAACTTTTAACTATAAAgt.........................aggag : 640114 121 : AspLysLeuProTyrProTyrAsp{A} >>>> Target Intron 7 >>>> : 129 |||...|||||| ...{!} 7574 bp AspSerLeuProThrGluLeuSer{G}+- ++ 640113 : gattctttaccaactgagctatca{g}gg.........................ag : 632514 130 : {sp}ProPheSerLeuMetThr{A} >>>> Target Intron 8 >>>> {s : 136 {!:} !|||!!!:!! !!{|} 18683 bp {| {lu}ValPheArgIle***Pro{A}++ ++{s 632513 : {AA}GTGTTCAGGATCTGACCA{G}gt.........................ag{A : 613808 137 : p}ProLysLeuIleIle{Tr} >>>> Target Intron 9 >>>> {p}Ser : 143 |}|||:!! !|||!!:{||} 94125 bp {|} p}ProGlnGluIleMet{Tr}-+ ++{p}Met 613807 : T}CCACAGGAGATAATG{TG}ct.........................ag{g}atg : 519663 144 : ProValArg{Ar} >>>> Target Intron 10 >>>> {g}SerAspVal : 151 |||... {||} 164891 bp {|}||| !!:!! ProAlaSer{Ar}++ ++{g}SerTyrLeu+ 519662 : cctgcctct{ag}gt..........................ag{G}TCTTATCTGg : 354748 152 : >>>> Target Intron 11 >>>> >>>> Target Intron 12 >>> : 151 4806 bp 8309 bp + ++++ 354747 : t..........................aggt......................... : 349940 152 : > >>>> Target Intron 13 >>>> AlaTrpAsnPheGluLysPheLe : 158 30404 bp ! !!.! !... !!:!:! ++++ ++IleHisLysCysSerGlyTyrVa 349939 : .aggt..........................agATTCACAAATGTTCTGGATATGT : 311208 159 : uIleGlyProGluGlyGluProPheArgArgTyrSer >>>> Target Intro : 171 !! !.!!|||..!!.!...! !|||!::|||:::... 35740 bp lAsnSerProSerAlaSerLeuPheGlnArgTrpLys-+ 311207 : GAACAGTCCCTCAGCATCTCTTTTTCagaggtggaaact................. : 311167 172 : n 14 >>>> ArgThrPheProThrIleAsnIleGluProAspIle : 182 ||||||||| ... ...||||||::: ++GlyIlePheProThrGlnGlySerAsnProAspLeu 311166 : .........aggggatcttcccaacccagggatcaaacccagatctc : 275394 vulgar: SPP00000005_1.0 14 182 . NIVO01055543.1 1200706 275393 - 103 M 24 72 5 0 2 I 0 175493 3 0 2 M 30 90 S 0 2 5 0 2 I 0 150608 3 0 2 S 1 1 M 15 45 S 0 1 5 0 2 I 0 5687 3 0 2 S 1 2 M 3 9 S 0 2 5 0 2 I 0 26180 3 0 2 S 1 1 M 17 51 5 0 2 I 0 66246 3 0 2 M 13 39 5 0 2 I 0 136039 3 0 2 M 9 27 S 0 1 5 0 2 I 0 7570 3 0 2 S 1 2 M 6 18 S 0 1 5 0 2 I 0 18679 3 0 2 S 1 2 M 5 15 S 0 2 5 0 2 I 0 94121 3 0 2 S 1 1 M 4 12 S 0 2 5 0 2 I 0 164887 3 0 2 S 1 1 M 3 9 5 0 2 I 0 4802 3 0 2 5 0 2 I 0 8305 3 0 2 5 0 2 I 0 30400 3 0 2 M 20 60 5 0 2 I 0 35736 3 0 2 M 12 36 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-17 ##type DNA # # # seqname source feature start end score strand frame attributes # NIVO01055543.1 exonerate:protein2genome:local gene 275394 1200706 103 - . gene_id 19 ; sequence SPP00000005_1.0 ; gene_orientation + NIVO01055543.1 exonerate:protein2genome:local cds 1200635 1200706 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1200635 1200706 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1200633 1200634 . - . intron_id 1 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 1025138 1200634 . - . intron_id 1 NIVO01055543.1 exonerate:protein2genome:local splice3 1025138 1025139 . - . intron_id 0 ; splice_site "TG" NIVO01055543.1 exonerate:protein2genome:local cds 1025046 1025137 . - . NIVO01055543.1 exonerate:protein2genome:local exon 1025046 1025137 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 1025044 1025045 . - . intron_id 2 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 874434 1025045 . - . intron_id 2 NIVO01055543.1 exonerate:protein2genome:local splice3 874434 874435 . - . intron_id 1 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 874387 874433 . - . NIVO01055543.1 exonerate:protein2genome:local exon 874387 874433 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 874385 874386 . - . intron_id 3 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 868696 874386 . - . intron_id 3 NIVO01055543.1 exonerate:protein2genome:local splice3 868696 868697 . - . intron_id 2 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 868683 868695 . - . NIVO01055543.1 exonerate:protein2genome:local exon 868683 868695 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 868681 868682 . - . intron_id 4 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 842499 868682 . - . intron_id 4 NIVO01055543.1 exonerate:protein2genome:local splice3 842499 842500 . - . intron_id 3 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 842447 842498 . - . NIVO01055543.1 exonerate:protein2genome:local exon 842447 842498 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 842445 842446 . - . intron_id 5 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 776197 842446 . - . intron_id 5 NIVO01055543.1 exonerate:protein2genome:local splice3 776197 776198 . - . intron_id 4 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 776158 776196 . - . NIVO01055543.1 exonerate:protein2genome:local exon 776158 776196 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 776156 776157 . - . intron_id 6 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 640115 776157 . - . intron_id 6 NIVO01055543.1 exonerate:protein2genome:local splice3 640115 640116 . - . intron_id 5 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 640087 640114 . - . NIVO01055543.1 exonerate:protein2genome:local exon 640087 640114 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 640085 640086 . - . intron_id 7 ; splice_site "gg" NIVO01055543.1 exonerate:protein2genome:local intron 632513 640086 . - . intron_id 7 NIVO01055543.1 exonerate:protein2genome:local splice3 632513 632514 . - . intron_id 6 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 632492 632512 . - . NIVO01055543.1 exonerate:protein2genome:local exon 632492 632512 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 632490 632491 . - . intron_id 8 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 613809 632491 . - . intron_id 8 NIVO01055543.1 exonerate:protein2genome:local splice3 613809 613810 . - . intron_id 7 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 613790 613808 . - . NIVO01055543.1 exonerate:protein2genome:local exon 613790 613808 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 613788 613789 . - . intron_id 9 ; splice_site "CT" NIVO01055543.1 exonerate:protein2genome:local intron 519665 613789 . - . intron_id 9 NIVO01055543.1 exonerate:protein2genome:local splice3 519665 519666 . - . intron_id 8 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 519650 519664 . - . NIVO01055543.1 exonerate:protein2genome:local exon 519650 519664 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 519648 519649 . - . intron_id 10 ; splice_site "gt" NIVO01055543.1 exonerate:protein2genome:local intron 354759 519649 . - . intron_id 10 NIVO01055543.1 exonerate:protein2genome:local splice3 354759 354760 . - . intron_id 9 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 354749 354758 . - . NIVO01055543.1 exonerate:protein2genome:local exon 354749 354758 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 354747 354748 . - . intron_id 11 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 349943 354748 . - . intron_id 11 NIVO01055543.1 exonerate:protein2genome:local splice3 349943 349944 . - . intron_id 10 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local splice5 349941 349942 . - . intron_id 12 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 341634 349942 . - . intron_id 12 NIVO01055543.1 exonerate:protein2genome:local splice3 341634 341635 . - . intron_id 11 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local splice5 341632 341633 . - . intron_id 13 ; splice_site "GT" NIVO01055543.1 exonerate:protein2genome:local intron 311230 341633 . - . intron_id 13 NIVO01055543.1 exonerate:protein2genome:local splice3 311230 311231 . - . intron_id 12 ; splice_site "AG" NIVO01055543.1 exonerate:protein2genome:local cds 311170 311229 . - . NIVO01055543.1 exonerate:protein2genome:local exon 311170 311229 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local splice5 311168 311169 . - . intron_id 14 ; splice_site "ct" NIVO01055543.1 exonerate:protein2genome:local intron 275430 311169 . - . intron_id 14 NIVO01055543.1 exonerate:protein2genome:local splice3 275430 275431 . - . intron_id 13 ; splice_site "ag" NIVO01055543.1 exonerate:protein2genome:local cds 275394 275429 . - . NIVO01055543.1 exonerate:protein2genome:local exon 275394 275429 . - . insertions 0 ; deletions 0 NIVO01055543.1 exonerate:protein2genome:local similarity 275394 1200706 103 - . alignment_id 19 ; Query SPP00000005_1.0 ; Align 1200707 15 72 ; Align 1025138 39 90 ; Align 874433 70 45 ; Align 868694 86 9 ; Align 842498 90 51 ; Align 776197 107 39 ; Align 640115 120 27 ; Align 632511 130 18 ; Align 613807 137 15 ; Align 519664 143 12 ; Align 354758 148 9 ; Align 311230 151 60 ; Align 275430 171 36 # --- END OF GFF DUMP --- # -- completed exonerate analysis