Command line: [exonerate -m p2g --showtargetgff -q ./SPP00000359_2.0.fa -t ./SPP00000359_2.0/fastasubseq/KV389606.1_fastasubseq.fa] Hostname: [ws101092U] C4 Alignment: ------------ Query: SPP00000359_2.0 # Protein # Selenoprotein I (SELENOI) # Marmoset Target: KV389606.1:subseq(44514,100272) Cebus capucinus imitator isolate Cc_AM_T3 unplaced genomic scaffold Scaffold180, whole genome shotgun sequence Model: protein2genome:local Raw score: 1966 Query range: 0 -> 379 Target range: 43707 -> 65569 1 : GlnTyrSerAlaValAspThrAsnProLeuSerLeuTyrValMetHisProPheTrpAsn : 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GlnTyrSerAlaValAspThrAsnProLeuSerLeuTyrValMetHisProPheTrpAsn 43708 : caGTACAGTGCTGTGGACACCAATCCACTTTCTTTGTATGTGATGCATCCATTTTGGAAC : 43765 21 : ThrIleValLys >>>> Target Intron 1 >>>> IlePheProThrTrpLeuA : 31 |||||||||||| 425 bp :!!|||||||||||||||| ThrIleValLys++ ++ValPheProThrTrpLeuA 43766 : ACTATAGTAAAGgt.........................agGTATTTCCTACTTGGCTGG : 44223 32 : laProAsnLeuIleThrPheSerGlyPheLeuLeuValValPheAsnPheLeuLeuMetA : 51 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| laProAsnLeuIleThrPheSerGlyPheLeuLeuValValPheAsnPheLeuLeuMetA 44224 : CTCCCAATCTGATAACTTTTTCTGGCTTTCTGCTGGTTGTATTCAATTTTCTGCTAATGG : 44283 52 : laTyrPheAspProAspPheTyrAlaSer{A} >>>> Target Intron 2 >>>> : 61 |||||||||||||||||||||||||||||{|} 2200 bp laTyrPheAspProAspPheTyrAlaSer{A}++ + 44284 : CATACTTTGATCCTGACTTTTATGCCTCA{G}gt.........................a : 46512 62 : {la}ProGlyHisLysHisValProAspTrpValTrpIleValValGlyIleLeuAsnP : 80 {||}||||||||||||||||||||||||||||||||||||||||||||||||||||||| +{la}ProGlyHisLysHisValProAspTrpValTrpIleValValGlyIleLeuAsnP 46513 : g{CA}CCGGGTCACAAGCATGTGCCTGACTGGGTTTGGATTGTAGTGGGCATCCTCAACT : 46570 81 : heValAlaTyrThrLeu{A} >>>> Target Intron 3 >>>> {sp}GlyValA : 89 |||||||||||||||||{|} 3421 bp {||}||||||| heValAlaTyrThrLeu{A}++ ++{sp}GlyValA 46571 : TTGTAGCCTACACTCTA{G}gt.........................ag{at}GGTGTAG : 50018 90 : spGlyLysGlnAlaArgArgThrAsnSerSerThrProLeuGlyGluLeuPheAspHisG : 109 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| spGlyLysGlnAlaArgArgThrAsnSerSerThrProLeuGlyGluLeuPheAspHisG 50019 : ACGGAAAGCAAGCTCGGAGAACCAATTCTAGCACTCCCTTAGGGGAGCTTTTTGACCATG : 50078 110 : lyLeuAspSerTrpSerCysValTyrPheValValThrValTyrSerIlePheGlyArgG : 129 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| lyLeuAspSerTrpSerCysValTyrPheValValThrValTyrSerIlePheGlyArgG 50079 : GCCTGGATAGTTGGTCATGTGTTTACTTTGTTGTAACTGTGTATTCCATCTTTGGAAGAG : 50138 130 : lySerThrGlyValSerValPheValLeuTyrLeuLeuLeuTrpValValLeuPheSerP : 149 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| lySerThrGlyValSerValPheValLeuTyrLeuLeuLeuTrpValValLeuPheSerP 50139 : GATCAACTGGTGTCAgtgtttttgttctttatctcCTGCTATgggtagttttgttttctt : 50198 150 : heIleLeuSerHisTrpGluLysTyrAsnThrGlyIleLeuPheLeuProTrpGlyTyrA : 169 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| heIleLeuSerHisTrpGluLysTyrAsnThrGlyIleLeuPheLeuProTrpGlyTyrA 50199 : tcatcctGTCCCATTGGGAAAAGTATAACACGGGGATTCTTTTCCTGCCATGGGGATATG : 50258 170 : spIleSerGlnVal >>>> Target Intron 4 >>>> ThrIleSerPheValTy : 179 |||||||||||||| 1310 bp ||||||||||||||||| spIleSerGlnVal++ ++ThrIleSerPheValTy 50259 : ACATTAGCCAGGTGgt.........................agACTATTTCTTTTGTCTA : 51598 180 : rIleValThrAlaValValGlyValGluAlaTrpTyrGluProPheLeuPheAsnPheLe : 199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| rIleValThrAlaValValGlyValGluAlaTrpTyrGluProPheLeuPheAsnPheLe 51599 : CATAGTGACTGCGGTTGTGGGAGTTGAGGCCTGGTATGAACCTTTCCTGTTTAATTTCTT : 51658 200 : uTyrArgAspLeuPheThrThrMetIleIle{G} >>>> Target Intron 5 >>> : 210 |||||||||||||||||||||||||||||||{|} 8233 bp uTyrArgAspLeuPheThrThrMetIleIle{G}++ 51659 : ATATAGAGACCTATTCACTACAATGATTATT{G}gt........................ : 51694 211 : > {ly}CysAlaLeuCysValThrLeuProMetSerLeuLeuAsnPhePhe{Ar} >> : 226 {||}|||||||||||||||||||||||||||||||||||||||||||||{||} ++{ly}CysAlaLeuCysValThrLeuProMetSerLeuLeuAsnPhePhe{Ar}++ 51695 : .ag{gC}TGTGCATTATGTGTGACTCTTCCAATGAGTTTATTAAACTTTTTC{ag}gt.. : 59976 227 : >> Target Intron 6 >>>> {g}SerTyrLysAsnAsnThrLeuLysHisAsnSe : 237 1415 bp {|}|||||||||||||||||||||||||||||||| ++{g}SerTyrLysAsnAsnThrLeuLysHisAsnSe 59977 : .......................ag{a}agctaTAAAAATAACACCTTGAAACACAATTC : 61420 238 : rValTyrGluAlaMetValProPhePheSerProCysLeuLeuPheIleLeuSerThrAl : 257 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| rValTyrGluAlaMetValProPhePheSerProCysLeuLeuPheIleLeuSerThrAl 61421 : AGTCTATGAAGCCATGgttcccttcttttctccatgCTTGCTGTTCATTTTGTCTACAGC : 61480 258 : aTrpIleLeuTrpSerProSerAspIleLeuGluIleHisProArgIlePheTyrPheMe : 277 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| aTrpIleLeuTrpSerProSerAspIleLeuGluIleHisProArgIlePheTyrPheMe 61481 : GTGGATCCTTTGGTCTCCTTCAGATATTTTAGAGATACATCCTAGAATATTCTACTTTAT : 61540 278 : tValGlyThrAlaPheAlaAsnIleThr >>>> Target Intron 7 >>>> Cys : 287 |||||||||||||||||||||||||||| 1288 bp ||| tValGlyThrAlaPheAlaAsnIleThr++ ++Cys 61541 : GGTTGGAACAGCCTTTGCCAATATCacagt.........................agTGT : 62858 288 : GlnLeuIleValCysGlnMetSerSerThrArgCysProThrLeuAsnTrpLeuLeuVal : 307 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GlnLeuIleValCysGlnMetSerSerThrArgCysProThrLeuAsnTrpLeuLeuVal 62859 : CAGCTGATTGTTTGCCAAATGAGTAGTACCCGGTGTCCAACTTTGAATTGGCTGCTGGTT : 62918 308 : ProLeuPheLeuValValLeuValValAsnLeuGlyValSerSerTyrIleGluSerIle : 327 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ProLeuPheLeuValValLeuValValAsnLeuGlyValSerSerTyrIleGluSerIle 62919 : CCTCTCTTCTTGGTTGTCTTAGTGGTAAACTTAGGAGTGTCCTCTTACATTGAGAGCATT : 62978 328 : IleLeuTyrThrLeuThrThrAlaPheThrLeuAlaHisIleHisTyrGlyValArgVal : 347 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| IleLeuTyrThrLeuThrThrAlaPheThrLeuAlaHisIleHisTyrGlyValArgVal 62979 : ATCCTATATACATTAACAACTGCTTTCACTCTGGCCCACATCCATTATGGAGTACGAGTG : 63038 348 : >>>> Target Intron 8 >>>> ValLysGlnLeuSerSerHisPheGlnIleT : 358 2433 bp ||||||||||||||||||||||||||||||| ++ ++ValLysGlnLeuSerSerHisPheGlnIleT 63039 : gt.........................agGTAAAGCAGCTGAGCAGCCATTTTCAGATTT : 65504 359 : yrProPheSerLeuArgLysProAsnSerAspUnkLeuGlyMetGluGluLysAsnIleG : 378 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| yrProPheSerLeuArgLysProAsnSerAsp***LeuGlyMetGluGluLysAsnIleG 65505 : ACCCCTTCTCATTGAGGAAACCAAACTCAGATTGACTaggaatggaagaaaagaatattg : 65564 379 : lyLeu : 379 ||||| lyLeu 65565 : gcctg : 65569 vulgar: SPP00000359_2.0 0 379 . KV389606.1:subseq(44514,100272) 43707 65569 + 1966 M 24 72 5 0 2 I 0 421 3 0 2 M 36 108 S 0 1 5 0 2 I 0 2196 3 0 2 S 1 2 M 24 72 S 0 1 5 0 2 I 0 3417 3 0 2 S 1 2 M 87 261 5 0 2 I 0 1306 3 0 2 M 36 108 S 0 1 5 0 2 I 0 8229 3 0 2 S 1 2 M 15 45 S 0 2 5 0 2 I 0 1411 3 0 2 S 1 1 M 60 180 5 0 2 I 0 1284 3 0 2 M 61 183 5 0 2 I 0 2429 3 0 2 M 32 96 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-18 ##type DNA # # # seqname source feature start end score strand frame attributes # KV389606.1:subseq(44514,100272) exonerate:protein2genome:local gene 43708 65569 1966 + . gene_id 1 ; sequence SPP00000359_2.0 ; gene_orientation + KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 43708 43779 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 43708 43779 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 43780 43781 . + . intron_id 1 ; splice_site "GT" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 43780 44204 . + . intron_id 1 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 44203 44204 . + . intron_id 0 ; splice_site "ag" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 44205 44313 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 44205 44313 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 44314 44315 . + . intron_id 2 ; splice_site "GT" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 44314 46513 . + . intron_id 2 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 46512 46513 . + . intron_id 1 ; splice_site "AG" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 46514 46588 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 46514 46588 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 46589 46590 . + . intron_id 3 ; splice_site "GT" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 46589 50009 . + . intron_id 3 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 50008 50009 . + . intron_id 2 ; splice_site "ag" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 50010 50272 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 50010 50272 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 50273 50274 . + . intron_id 4 ; splice_site "GT" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 50273 51582 . + . intron_id 4 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 51581 51582 . + . intron_id 3 ; splice_site "AG" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 51583 51691 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 51583 51691 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 51692 51693 . + . intron_id 5 ; splice_site "GT" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 51692 59924 . + . intron_id 5 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 59923 59924 . + . intron_id 4 ; splice_site "ag" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 59925 59973 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 59925 59973 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 59974 59975 . + . intron_id 6 ; splice_site "gt" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 59974 61388 . + . intron_id 6 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 61387 61388 . + . intron_id 5 ; splice_site "ag" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 61389 61569 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 61389 61569 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 61570 61571 . + . intron_id 7 ; splice_site "gt" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 61570 62857 . + . intron_id 7 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 62856 62857 . + . intron_id 6 ; splice_site "AG" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 62858 63040 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 62858 63040 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice5 63041 63042 . + . intron_id 8 ; splice_site "GT" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local intron 63041 65473 . + . intron_id 8 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local splice3 65472 65473 . + . intron_id 7 ; splice_site "AG" KV389606.1:subseq(44514,100272) exonerate:protein2genome:local cds 65474 65569 . + . KV389606.1:subseq(44514,100272) exonerate:protein2genome:local exon 65474 65569 . + . insertions 0 ; deletions 0 KV389606.1:subseq(44514,100272) exonerate:protein2genome:local similarity 43708 65569 1966 + . alignment_id 1 ; Query SPP00000359_2.0 ; Align 43708 1 72 ; Align 44205 25 108 ; Align 46516 62 72 ; Align 50012 87 261 ; Align 51583 174 108 ; Align 59927 211 45 ; Align 61390 227 180 ; Align 62858 287 183 ; Align 65474 348 96 # --- END OF GFF DUMP --- # -- completed exonerate analysis