Command line: [exonerate -m p2g --showtargetgff -q ./SPP00000382_2.0.fa -t ./SPP00000382_2.0/fastasubseq/KV389513.1_fastasubseq.fa] Hostname: [ws101092U] C4 Alignment: ------------ Query: SPP00000382_2.0 # Protein # tRNA Sec 1 associated protein 1 (SECp43) # Marmoset Target: KV389513.1:subseq(6318282,100164) Cebus capucinus imitator isolate Cc_AM_T3 unplaced genomic scaffold Scaffold87, whole genome shotgun sequence Model: protein2genome:local Raw score: 262 Query range: 0 -> 80 Target range: 39851 -> 50797 1 : GlyMetValAlaSerLeuTrpMetGlyAsp >>>> Target Intron 1 >>>> L : 11 ||||||!.!||||||||||||||||||||| 520 bp GlyMetAlaAlaSerLeuTrpMetGlyAsp++ +-G 39852 : GGCATGGCGGCCAGCCTGTGGATGGGCGACgt.........................atG : 40402 12 : euGluProTyrMetAspGluAsnPheLeuMetGlyGluThrValMetSerIleLysPheI : 31 !.!. ! ! ! ! ! !|||||||||||||||||||||:!!|||.!!| luAsnPheIleSerArgAlaPheAlaThrMetGlyGluThrValMetSerValLysIleI 40403 : AGAACTTCATCTCCAGAGCCTTTGCCACCATGGGGGAGACTGTAATGAGCGTCAAAATTA : 40462 32 : le<->AsnArgLeuThr{Gl} >>>> Target Intron 2 >>>> {y}IleProA : 39 || ||||||||||||{||} 9568 bp {|}||||||| leArgAsnArgLeuThr{Gl}++ ++{y}IleProA 40463 : TCCGAAACCGCCTCACC{GG}gt.........................ag{G}ATCCCAG : 50057 40 : laGlyTyrCysPheValGlu<->AlaAspLeuValThrAlaGluLysCysLeuHisLysI : 58 |||||||||||||||||||| |||||||||!.!||||||||||||||||||||||||| laGlyTyrCysPheValGluPheAlaAspLeuAlaThrAlaGluLysCysLeuHisLysI 50058 : CTGGCTACTGCTTTGTAGAATTTGCAGATTTGGCCACAGCTGAGAAGTGTTTGCATAAAA : 50117 59 : leAsnGlyLysProLeuProGlyAlaThrPro >>>> Target Intron 3 >>>> : 69 |||||||||||||||||||||||||||||||| 612 bp leAsnGlyLysProLeuProGlyAlaThrPro++ + 50118 : TTAATGGGAAACCCCTTCCAGGAGCCACACCTgt.........................a : 50760 70 : ValLysArgPheLysLeuAsnTyrAlaThrTyrGly : 80 ..!||||||||||||||||||||||||||||||||| +AlaLysArgPheLysLeuAsnTyrAlaThrTyrGly 50761 : ggcGAAACGTTTTAAACTCAACTATGCCACTTATGGG : 50797 vulgar: SPP00000382_2.0 0 80 . KV389513.1:subseq(6318282,100164) 39851 50797 + 262 M 10 30 5 0 2 I 0 516 3 0 2 M 21 63 G 0 3 M 4 12 S 0 2 5 0 2 I 0 9564 3 0 2 S 1 1 M 9 27 G 0 3 M 23 69 5 0 2 I 0 608 3 0 2 M 12 36 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-18 ##type DNA # # # seqname source feature start end score strand frame attributes # KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local gene 39852 50797 262 + . gene_id 1 ; sequence SPP00000382_2.0 ; gene_orientation + KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local cds 39852 39881 . + . KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local exon 39852 39881 . + . insertions 0 ; deletions 0 KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local splice5 39882 39883 . + . intron_id 1 ; splice_site "GT" KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local intron 39882 40401 . + . intron_id 1 KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local splice3 40400 40401 . + . intron_id 0 ; splice_site "AT" KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local cds 40402 40481 . + . KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local exon 40402 40481 . + . insertions 3 ; deletions 0 KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local splice5 40482 40483 . + . intron_id 2 ; splice_site "GT" KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local intron 40482 50049 . + . intron_id 2 KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local splice3 50048 50049 . + . intron_id 1 ; splice_site "ag" KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local cds 50050 50149 . + . KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local exon 50050 50149 . + . insertions 3 ; deletions 0 KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local splice5 50150 50151 . + . intron_id 3 ; splice_site "GT" KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local intron 50150 50761 . + . intron_id 3 KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local splice3 50760 50761 . + . intron_id 2 ; splice_site "ag" KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local cds 50762 50797 . + . KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local exon 50762 50797 . + . insertions 0 ; deletions 0 KV389513.1:subseq(6318282,100164) exonerate:protein2genome:local similarity 39852 50797 262 + . alignment_id 1 ; Query SPP00000382_2.0 ; Align 39852 1 30 ; Align 40402 11 63 ; Align 40468 32 12 ; Align 50051 37 27 ; Align 50081 46 69 ; Align 50762 69 36 # --- END OF GFF DUMP --- # -- completed exonerate analysis