Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q TXNRD2.anole.fa -t TXNRD2.extraccio.KQ749205.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000137_2.0 # Protein # Thioredoxin reductase 2 (TXNRD2) # Human Target: KQ749205.1:subseq(743986,96609) Gekko japonicus isolate JY-2015 unplaced genomic scaffold scaffold490, whole genome shotgun sequence Model: protein2genome:local Raw score: 1767 Query range: 1 -> 494 Target range: 186 -> 76609 2 : GluAspGlnAla{G} >>>> Target Intron 1 >>>> {ly}GlnArgAspTyr : 10 :!!|||||| !!{|} 17675 bp {||}:!! !!!:||| GlnAspGlnPro{G}++ ++{ly}LysTyrGluTyr 187 : CAGGACCAACCT{G}gt.........................ag{GG}AAGTACGAATAT : 17886 11 : AspLeuLeuValValGlyGlyGlySerGlyGlyLeuAlaCysAlaLys >>>> Targe : 27 |||||||||||||||||||||||||||||||||||||||||||||||| 2 AspLeuLeuValValGlyGlyGlySerGlyGlyLeuAlaCysAlaLys+- 17887 : GATCTGCTAGTTGTTGGAGGAGGATCTGGCGGCCTTGCTTGCGCGAAAga.......... : 17939 28 : t Intron 2 >>>> GluAlaAlaGlnLeuGlyArgLysValAlaValValAspTyrV : 41 057 bp ... !!||||||!!!|||!.!||||||||||||:!!||||||| -+SerProAlaGlnPheGlyAsnLysValAlaValLeuAspTyrV 17940 : ...............tgagtcCAGCTCAGTTTGGAAACAAGGTGGCTGTCTTAGACTACG : 20036 42 : alGluProSerProGln{G} >>>> Target Intron 3 >>>> {ly}ThrArgT : 50 ||!!:|||||||||:!!{|} 3480 bp {||}|||!:!| alAspProSerProLys{G}++ ++{ly}ThrLysT 20037 : TGGATCCTTCTCCGAAA{G}gt.........................ag{gc}ACCAAAT : 23543 51 : rpGlyLeuGlyGlyThrCysValAsnValGlyCysIleProLysLysLeuMetHisGlnA : 70 |||||:!!||||||||||||||||||||||||||||||||||||||||||||||||!!.| rpGlyIleGlyGlyThrCysValAsnValGlyCysIleProLysLysLeuMetHisHisA 23544 : GGGGAATTGGCGGTACTTGTGTGAACGTTGGCTGCATTCCTAAAAAGCTCATGCACCATG : 23603 71 : laAlaLeuLeuGlyGlyLeuIleGlnAspAlaProAsnTyrGlyTrpGluValAlaGlnP : 90 ||||||||||||||.!! !:!!:!!||||||! !:!!|||||||||...:!! !!|||| laAlaLeuLeuGlySerAlaLeuLysAspAlaGlnHisTyrGlyTrpSerIleProGlnP 23604 : CAGCCCTTCTGGGGAGCGCTCTCAAAGATGCCCAGCACTATGGCTGGAGCATACCTCAGC : 23663 91 : roValProHisAsp{Tr} >>>> Target Intron 4 >>>> {p}ArgLysMetA : 99 ||||| !!||||||{||} 3204 bp {|} !! !|||| roValThrHisAsp{Tr}++ ++{p}SerThrMetA 23664 : CTGTGACCCATGAC{tg}gt.........................ag{G}TCTACAATGG : 26894 100 : laGluAlaValGlnAsnHisValLysSerLeuAsnTrpGlyHisArgValGlnLeuGlnA : 119 ||||||||:!!|||||||||||||||||||||||||||||||||||| !|||||||||| laGluAlaIleGlnAsnHisValLysSerLeuAsnTrpGlyHisArgArgGlnLeuGlnA 26895 : CTGAAGCCATTCAAAACCATGTGAAATCCTTGAACTGGGGACACAGAAGGCAACTGCAGG : 26954 120 : sp{Ar} >>>> Target Intron 5 >>>> {g}LysValLysTyrPheAsnIleL : 128 ||{!:} 1107 bp {!}||||||||||||||||||:!:| sp{Ly}++ ++{s}LysValLysTyrPheAsnLeuL 26955 : AT{AA}gt.........................ag{A}AAAGTGAAGTACTTCAACTTGA : 28088 129 : ysAlaSerPheValAspGluHisThrValCysGlyValAlaLysGlyGlyLysGlu >> : 147 ||!.!||||||||||||! ||||||:!! !!|||:!!:!!|||!.!|||:!!||| ysGlySerPheValAspAlaHisThrIleArgGlyLeuSerLysAlaGlyGlnGlu++ 28089 : AAGGCAGCTTTGTGGACGCTCACACGATTCGCGGGTTGTCAAAAGCAGGCCAAGAGgt.. : 28147 148 : >> Target Intron 6 >>>> IleLeuLeuSerAlaAspHisIleIleIleAlaTh : 158 1907 bp ! !||||||!!!|||!!::!!|||:!!:!!||||| ++ThrLeuLeuThrAlaGluAsnIleValLeuAlaTh 28148 : .......................agACTTTGCTCACAGCAGAAAACATAGTCCTTGCCAC : 30085 159 : rGlyGlyArgProArgTyrProThrHis >>>> Target Intron 7 >>>> Ile : 168 ||||||||||||| !||||||.!!:!! 919 bp ||| rGlyGlyArgProAlaTyrProAlaAsn++ ++Ile 30086 : TGGTGGGAGGCCTGCATATCCTGCAAATgt.........................agATT : 31034 169 : GluGlyAlaLeuGluTyrGlyIleThrSerAspAspIlePheTrpLeuLysGluSerPro : 188 ||||||||||||:!!||||||||||||||||||:!!||||||||||||:!!|||||| ProGlyAlaLeuGluHisGlyIleThrSerAspAspLeuPheTrpLeuLysLysSerPro 31035 : CCTGGGGCGCTGGAGCATGGGATTACAAGTGACGATCTCTTCTGGCTGAAAAAATCTCCT : 31094 189 : GlyLys{Th} >>>> Target Intron 8 >>>> {r}LeuValValGlyAlaSer : 197 ||||||{||} 8456 bp {|}|||:!!|||||||||||| GlyLys{Th}++ ++{r}LeuLeuValGlyAlaSer 31095 : GGGAAA{AC}gt.........................ag{G}TTGCTTGTTGGAGCCAGC : 39577 198 : {T} >>>> Target Intron 9 >>>> {yr}ValAlaLeuGluCysAlaGlyPhe : 206 {|} 1872 bp {||}|||:!!|||||||||||||||||| {T}++ ++{yr}ValSerLeuGluCysAlaGlyPhe 39578 : {T}gt.........................ag{AT}GTTTCCCTGGAGTGCGCTGGCTTT : 41476 207 : LeuThrGlyIleGlyLeuAspThrThrIleMetMetArgSerIleProLeuArgGlyPhe : 226 |||||||||:!! !!||||||||||||:!!|||:!:|||||||||||||||||||||||| LeuThrGlyLeuArgLeuAspThrThrValMetValArgSerIleProLeuArgGlyPhe 41477 : CTCACGGGCCTCAGGTTGGATACTACGGTCATGGTCAGGAGCATCCCTCTTCGAGGATTT : 41536 227 : AspGln >>>> Target Intron 10 >>>> GlnMetSerSerMetValIleGlu : 236 |||||| 5090 bp ||||||:!!!!!:!:|||! !!!: AspGln++ ++GlnMetAlaThrLeuValThrAsp 41537 : GACCAGgt..........................agCAAATGGCCACCTTAGTGACAGAT : 46656 237 : HisMetAlaSerHisGlyThrArgPheLeuArgGlyCysAlaProSerArgValArgArg : 256 :!!|||! !:!!||||||||||||||||||::: |||::!|||!!!!:!|||..!!:! TyrMetGluAlaHisGlyThrArgPheLeuLysLysCysSerProThrLysValGluLys 46657 : TATATGGAAGCCCACGGCACGaggtttttaaagaaatgcagCCCAACTAAAGTGGAGAAG : 46716 257 : LeuProAspGlyGlnLeuGlnValThrTrpGluAspSerThrThrGlyLysGluAspThr : 276 :!! !||||||::!:!!!:!|||..!|||:!! !!||| !:!!|||||||||! ||| MetGluAspGlyArgValArgValValTrpLysHisSerAspSerGlyLysGluGlyThr 46717 : ATGGAAGATGGCAGAGTGCGAGTTGTGTGGAAACACAGTGACTCTGGCAAAGAAGGAACA : 46776 277 : GlyThrPheAspThrValLeuTrpAlaIle{G} >>>> Target Intron 11 >>> : 287 ! ! !|||||||||:!!:!!||||||:!!{|} 13423 bp AspGluPheAspThrLeuMetTrpAlaVal{G}++ 46777 : GACGAATTTGATACGCTGATGTGGGCAGTA{g}gt......................... : 46812 288 : > {ly}ArgValProAspThrArgSerLeuAsnLeuGluLysAlaGlyValAspThrSe : 305 {||}||| !|||||||||!:!!!!||||||||||||! ||||||||| ! ! !!: ++{ly}ArgGlnProAspThrLysThrLeuAsnLeuGluThrAlaGlyValLysIleAs 46813 : .ag{GC}CGGCAGCCTGACACCAAGACCCTTAATCTGGAGACTGCGGGTGTGAAAATTAA : 60286 306 : rProAspThrGlnLysIleLeuValAspSerArgGluAlaThrSerValProHisIleTy : 325 ! !!! .!! !||||||:!!||||||:!!!!!|||||||||||||||||||||||||| nSerAlaAlaGlyLysIleIleValAspAlaSerGluAlaThrSerValProHisIleTy 60287 : CTCTGCAGCGGGAAAGATCATTGTTGATGCAAGCGAAGCCACTTCTGTACCTCACATTTA : 60346 326 : rAlaIleGlyAspValValGlu >>>> Target Intron 12 >>>> GlyArgPr : 335 ||||:!!||||||:!!..!||| 3994 bp |||||||| rAlaValGlyAspIleThrGlu++ ++GlyArgPr 60347 : TGCTGTCGGAGACATTACAGAGgt..........................agGGTCGCCC : 64370 336 : oGluLeuThrProIleAlaIleMetAlaGlyArgLeuLeuValGlnArgLeuPheGlyGl : 355 |||||||||||||! !|||||| ||||||!:!||||||!.!!:!|||||||||||| oGluLeuThrProThrAlaIleAlaAlaGlyLysLeuLeuAlaArgArgLeuPheGlyGl 64371 : TGAACTAACACCGACTGCAATCGCTGCGGGGAAACTGCTGGCTCGGCGTTTGTTTGGCCA : 64430 356 : ySerSerAspLeuMetAspTyrAspAsn >>>> Target Intron 13 >>>> Va : 365 !|||!.!!!:|||||||||||||||||| 605 bp || nSerLysGluLeuMetAspTyrAspAsn++ ++Va 64431 : GTCGAAAGAACTAATGGATTATGACAATgt..........................agGT : 65065 366 : lProThrThrValPheThrProLeuGluTyrGlyCysValGlyLeuSerGluGluGluAl : 385 |||||||||||||||||||||||||||||||||||||||||||||||||||||||:!!|| lProThrThrValPheThrProLeuGluTyrGlyCysValGlyLeuSerGluGluGlnAl 65066 : ACCTACTACTGTTTTCACACCCCTTGAATATGGATGTGTTGGTCTCTCAGAAGAACAAGC : 65125 386 : aValAlaArgHisGlyGlnGluHisValGlu >>>> Target Intron 14 >>>> : 396 | !::!!.! |||! !!!::!!|||||| 1807 bp aSerSerHisLeuGlyProAspAsnValGlu++ + 65126 : TTCAAGCCATTTGGGGCCAGATAACGTAGAGgt..........................a : 66963 397 : ValTyrHisAlaHisTyrLysProLeuGluPheThrValAlaGlyArgAspAlaSerGl : 415 |||||||||||| !|||||||||||||||||| !||| !!||||||||||||:!!|| +ValTyrHisAlaPheTyrLysProLeuGluPheTyrValProGlyArgAspAlaAlaGl 66964 : gGTGTACCATGCATTTTATAAGCCCTTGGAATTTTACGTGCCTGGAAGAGATGCTGCCCA : 67022 416 : nCysTyrValLys >>>> Target Intron 15 >>>> MetValCysLeuArgGl : 425 |||||||:!!||| 2554 bp |||||||||! !|||! nCysTyrIleLys++ ++MetValCysSerArgAl 67023 : GTGTTACATAAAAgt..........................agATGGTATGTTCACGTGC : 69606 426 : uProProGlnLeuValLeuGlyLeuHisPheLeuGlyProAsnAlaGlyGluValThrGl : 445 !! ! !|||! !:!!|||||||||||||||:!!|||||||||||||||||||||! !|| aHisGluGlnArgIleLeuGlyLeuHisPheIleGlyProAsnAlaGlyGluValIleGl 69607 : ACATGAACAGCGAATCCTTGGCCTTCATTTCATCGGTCCAAATGCCGGCGAAGTTATTCA : 69666 446 : nGlyPheAlaLeuGlyIle{Ly} >>>> Target Intron 16 >>>> {s}CysG : 454 |||||||||||||||||||{||} 6794 bp {|}|||| nGlyPheAlaLeuGlyIle{Ly}++ ++{s}CysG 69667 : AGGATTTGCCCTTGGAATC{AA}gt..........................ag{G}TGCG : 76487 455 : lyAlaSerTyrAlaGlnValMetArgThrValGlyIleHisProThrCysSerGluGluV : 474 |||||!!!|||:!!|||:!!:!!!:!||||||||||||||||||||||||:!!||||||| lyAlaThrTyrSerGlnMetLeuLysThrValGlyIleHisProThrCysAlaGluGluV 76488 : GCGCCACCTACTCACAAATGCTGAAGACGGTGGGCATTCACCCGACTTGCGCCGAGGAAG : 76547 475 : alValLysLeuArgIleSerLysArgSerGlyLeuAspProThrValThrGlyCysUnkG : 494 ||..!||||||!.!|||!!!|||||||||||||||||| !!||||||||||||||| | alThrLysLeuHisIleThrLysArgSerGlyLeuAspAlaThrValThrGlyCys***G 76548 : TCACAAAGCTGCACATCACAAAGCGGTCGGGCTTGGATGCCACCGTCACTGGCTGCTGAG : 76607 495 : ly : 494 || ly 76608 : GT : 76609 vulgar: SPP00000137_2.0 1 494 . KQ749205.1:subseq(743986,96609) 186 76609 + 1767 M 4 12 S 0 1 5 0 2 I 0 17671 3 0 2 S 1 2 M 20 60 5 0 2 I 0 2053 3 0 2 M 20 60 S 0 1 5 0 2 I 0 3476 3 0 2 S 1 2 M 47 141 S 0 2 5 0 2 I 0 3200 3 0 2 S 1 1 M 24 72 S 0 2 5 0 2 I 0 1103 3 0 2 S 1 1 M 26 78 5 0 2 I 0 1903 3 0 2 M 21 63 5 0 2 I 0 915 3 0 2 M 23 69 S 0 2 5 0 2 I 0 8452 3 0 2 S 1 1 M 6 18 S 0 1 5 0 2 I 0 1868 3 0 2 S 1 2 M 30 90 5 0 2 I 0 5086 3 0 2 M 58 174 S 0 1 5 0 2 I 0 13419 3 0 2 S 1 2 M 45 135 5 0 2 I 0 3990 3 0 2 M 32 96 5 0 2 I 0 601 3 0 2 M 31 93 5 0 2 I 0 1803 3 0 2 M 24 72 5 0 2 I 0 2550 3 0 2 M 32 96 S 0 2 5 0 2 I 0 6790 3 0 2 S 1 1 M 42 126 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-12-03 ##type DNA # # # seqname source feature start end score strand frame attributes # KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local gene 187 76609 1767 + . gene_id 1 ; sequence SPP00000137_2.0 ; gene_orientation + KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 187 199 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 187 199 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 200 201 . + . intron_id 1 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 200 17874 . + . intron_id 1 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 17873 17874 . + . intron_id 0 ; splice_site "aG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 17875 17936 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 17875 17936 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 17937 17938 . + . intron_id 2 ; splice_site "GA" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 17937 19993 . + . intron_id 2 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 19992 19993 . + . intron_id 1 ; splice_site "tg" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 19994 20054 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 19994 20054 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 20055 20056 . + . intron_id 3 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 20055 23534 . + . intron_id 3 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 23533 23534 . + . intron_id 2 ; splice_site "ag" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 23535 23679 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 23535 23679 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 23680 23681 . + . intron_id 4 ; splice_site "gt" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 23680 26883 . + . intron_id 4 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 26882 26883 . + . intron_id 3 ; splice_site "ag" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 26884 26958 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 26884 26958 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 26959 26960 . + . intron_id 5 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 26959 28065 . + . intron_id 5 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 28064 28065 . + . intron_id 4 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 28066 28144 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 28066 28144 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 28145 28146 . + . intron_id 6 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 28145 30051 . + . intron_id 6 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 30050 30051 . + . intron_id 5 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 30052 30114 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 30052 30114 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 30115 30116 . + . intron_id 7 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 30115 31033 . + . intron_id 7 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 31032 31033 . + . intron_id 6 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 31034 31104 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 31034 31104 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 31105 31106 . + . intron_id 8 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 31105 39560 . + . intron_id 8 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 39559 39560 . + . intron_id 7 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 39561 39580 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 39561 39580 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 39581 39582 . + . intron_id 9 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 39581 41452 . + . intron_id 9 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 41451 41452 . + . intron_id 8 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 41453 41544 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 41453 41544 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 41545 41546 . + . intron_id 10 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 41545 46634 . + . intron_id 10 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 46633 46634 . + . intron_id 9 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 46635 46809 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 46635 46809 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 46810 46811 . + . intron_id 11 ; splice_site "gt" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 46810 60232 . + . intron_id 11 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 60231 60232 . + . intron_id 10 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 60233 60369 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 60233 60369 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 60370 60371 . + . intron_id 12 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 60370 64363 . + . intron_id 12 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 64362 64363 . + . intron_id 11 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 64364 64459 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 64364 64459 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 64460 64461 . + . intron_id 13 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 64460 65064 . + . intron_id 13 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 65063 65064 . + . intron_id 12 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 65065 65157 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 65065 65157 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 65158 65159 . + . intron_id 14 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 65158 66964 . + . intron_id 14 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 66963 66964 . + . intron_id 13 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 66965 67036 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 66965 67036 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 67037 67038 . + . intron_id 15 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 67037 69590 . + . intron_id 15 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 69589 69590 . + . intron_id 14 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 69591 69688 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 69591 69688 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice5 69689 69690 . + . intron_id 16 ; splice_site "GT" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local intron 69689 76482 . + . intron_id 16 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local splice3 76481 76482 . + . intron_id 15 ; splice_site "AG" KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local cds 76483 76609 . + . KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local exon 76483 76609 . + . insertions 0 ; deletions 0 KQ749205.1:subseq(743986,96609) exonerate:protein2genome:local similarity 187 76609 1767 + . alignment_id 1 ; Query SPP00000137_2.0 ; Align 187 2 12 ; Align 17877 7 60 ; Align 19994 27 60 ; Align 23537 48 141 ; Align 26885 96 72 ; Align 28067 121 78 ; Align 30052 147 63 ; Align 31034 168 69 ; Align 39562 192 18 ; Align 41455 199 90 ; Align 46635 229 174 ; Align 60235 288 135 ; Align 64364 333 96 ; Align 65065 365 93 ; Align 66965 396 72 ; Align 69591 420 96 ; Align 76484 453 126 # --- END OF GFF DUMP --- # -- completed exonerate analysis