Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q SELENOW2.anole.fa -t SELENOW2.extraccio.KQ752146.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000127_2.0 # Protein # Selenoprotein W2 (SELENOW2) # Human Target: KQ752146.1:subseq(166799,44984) Gekko japonicus isolate JY-2015 unplaced genomic scaffold scaffold875, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 442 Query range: 17 -> 115 Target range: 26617 -> 19999 18 : GluProGlySerGlyValArgIleValValGluTyr{Cy} >>>> Target Intron : 30 ||| !!|||!!!||||||||||||||||||||||||{||} 1594 bp GluAlaGlyArgGlyValArgIleValValGluTyr{Cy}++ 26617 : GAGGCCGGAAGAGGAGTCCGGATCGTTGTCGAGTAC{TG}gt.................. : 26577 31 : 1 >>>> {s}GluProCysGlyPheGluAlaThrTyrLeuGluLeuAlaSerAlaVal : 46 {|}:!!|||||||||||||||:!!.!!|||||||||||||||||||||||| ++{s}LysProCysGlyPheGluSerAlaTyrLeuGluLeuAlaSerAlaVal 26576 : .......ag{C}AAGCCCTGCGGCTTTGAGTCCGCGTACCTGGAGCTGGCGAGTGCAGTC : 24939 47 : LysGluGlnTyrProGlyIleGluIleGluSerArgLeuGlyGlyThr{G} >>>> Ta : 63 ||||||:!!||||||! !:!:|||||||||||||||||||||||||||{|} LysGluGluTyrProAspValGluIleGluSerArgLeuGlyGlyThr{G}++ 24938 : AAGGAGGAGTATCCAGATGTGGAGATCGAGTCCCGACTTGGAGGAACA{G}gt....... : 24885 64 : rget Intron 2 >>>> {ly}AlaPheGluIleGluIleAsnGlyGlnLeuValPhe : 75 2699 bp {||}|||||||||||||||||||||||||||||||||||| ++{ly}AlaPheGluIleGluIleAsnGlyGlnLeuValPhe 24884 : ..................ag{GC}GCCTTTGAGATTGAAATAAATGGCCAGCTGGTCTTC : 22153 76 : SerLysLeuGluAsnGlyGlyPheProTyrGluLysAsp >>>> Target Intron : 89 ||||||||||||||||||||||||||||||||||||||| 2031 bp SerLysLeuGluAsnGlyGlyPheProTyrGluLysAsp++ 22152 : TCCAAGCTCGAGAACGGAGGATTCCCCTACGAGAAAGATgt................... : 22109 90 : 3 >>>> LeuIleGluAlaIleArgArgAlaSerAsnGlyGluThrLeuGluLysIleT : 106 ||||||||||||||||||||||||!!!||||||||| !!||||||||||||| ++LeuIleGluAlaIleArgArgAlaArgAsnGlyGluProLeuGluLysIleT 22108 : ......agCTCATCGAAGCCATCCGGAGGGCCAGAAATGGGGAGCCGCTCGAGAAGATCA : 20029 107 : hrAsnSerArgProProCysValIleLeu : 115 ||!!.|||||||||||||||||||||||| hrLysSerArgProProCysValIleLeu 20028 : CCAAGAGCCGTCCGCCGTGCGTCATCCTt : 20000 vulgar: SPP00000127_2.0 17 115 . KQ752146.1:subseq(166799,44984) 26617 19999 - 442 M 12 36 S 0 2 5 0 2 I 0 1590 3 0 2 S 1 1 M 32 96 S 0 1 5 0 2 I 0 2695 3 0 2 S 1 2 M 25 75 5 0 2 I 0 2027 3 0 2 M 27 81 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-12-01 ##type DNA # # # seqname source feature start end score strand frame attributes # KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local gene 20000 26617 442 - . gene_id 1 ; sequence SPP00000127_2.0 ; gene_orientation + KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local cds 26580 26617 . - . KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local exon 26580 26617 . - . insertions 0 ; deletions 0 KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local splice5 26578 26579 . - . intron_id 1 ; splice_site "GT" KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local intron 24986 26579 . - . intron_id 1 KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local splice3 24986 24987 . - . intron_id 0 ; splice_site "AG" KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local cds 24888 24985 . - . KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local exon 24888 24985 . - . insertions 0 ; deletions 0 KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local splice5 24886 24887 . - . intron_id 2 ; splice_site "GT" KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local intron 22189 24887 . - . intron_id 2 KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local splice3 22189 22190 . - . intron_id 1 ; splice_site "AG" KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local cds 22112 22188 . - . KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local exon 22112 22188 . - . insertions 0 ; deletions 0 KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local splice5 22110 22111 . - . intron_id 3 ; splice_site "GT" KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local intron 20081 22111 . - . intron_id 3 KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local splice3 20081 20082 . - . intron_id 2 ; splice_site "AG" KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local cds 20000 20080 . - . KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local exon 20000 20080 . - . insertions 0 ; deletions 0 KQ752146.1:subseq(166799,44984) exonerate:protein2genome:local similarity 20000 26617 442 - . alignment_id 1 ; Query SPP00000127_2.0 ; Align 26618 18 36 ; Align 24985 31 96 ; Align 22187 64 75 ; Align 20081 89 81 # --- END OF GFF DUMP --- # -- completed exonerate analysis