Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q SELENOM.anole.fa -t SELENOM.extraccio.KQ753014.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000077_2.0 # Protein # Selenoprotein M (SELENOM) # Human Target: KQ753014.1:subseq(74829,40125) Gekko japonicus isolate JY-2015 unplaced genomic scaffold scaffold1928, whole genome shotgun sequence Model: protein2genome:local Raw score: 211 Query range: 0 -> 135 Target range: 11152 -> 20125 1 : MetSerLeuLeuLeuProProLeuAlaLeuLeuLeuLeuLeuAlaAlaLeuValAlaPro : 20 :!!.!!||||||:::|||||| ||| ||||||||| ! !|||:!!:!! ! LeuGlyLeuLeuIleProProProProLeuProLeuLeuLeuLeuLeuLeuLeuSerGly 11153 : TTGGGGCTCCTGattccgccgccgccgctgccgctgctgctcttGCTCCTCCTGTCGGGG : 11210 21 : AlaThrAlaAlaThrAlaTyrArgProAspTrpAsnArgLeuSerGlyLeuThrArgAla : 40 !!..! !!.!..!! ! ! ||| !!!:!||||||..!||||||.!!|||!.! ProValArgGlyValGluIle------AspArgSerArgLeuGluGlyLeuAlaArgGly 11211 : CCGGTGCGGGGCGTTGAAATC------GATCGGAGCCGCCTAGAGGGACTGGCGCGGGGC : 11264 41 : ArgValGlu >>>> Target Intron 1 >>>> ThrCysGlyGlyUnkGlnLeuA : 51 !:!|||||| 4507 bp :!!||||||||| !:!|||| LysValGlu++ ++SerCysGlyGly***ArgLeuA 11265 : AAAGTGGAGgt.........................agTCTTGCGGAGGATGACGATTGA : 15804 52 : snArgLeuLysGluValLysAlaPheValThrGln{As} >>>> Target Intron : 63 |||||||||||||||||!..!.! ! !.!!...{ } 949 bp snArgLeuLysGluValSerValAla***AlaSer{Cy}++ 15805 : ATCGCTTGAAAGAGGTAAGTGTTGCTTAAGCTTCT{TG}gt................... : 15844 64 : 2 >>>> {p}IleProPheTyrHisAsnLeuValMetLysHisLeuProGlyAlaAspP : 80 {!}:!!! !!!.!:!||| !!! ! ! !.!! !! !..!!.!...| ++{s}LeuGlnLeuPheHisTyrCysProGluCysArgCysGlnAsnGlySerP 15845 : ......ag{T}CTCCAGTTATTTCACTACTGTCCAGAATGCCGCTGCCAAAATGGTTCAC : 16840 81 : roGluLeuValLeuLeuGlyArg{A} >>>> Target Intron 3 >>>> {rg}T : 89 ||...! !:!! !:!! ! !{ } 973 bp { !}: roSerSerLeuThrValTyrAsp{A}-+ ++{la}P 16841 : CTTCCTCATTGACTGTATATGAT{G}at.........................ag{ct}t : 17840 90 : yrGluGluLeuGlu >>>> Target Intron 4 >>>> ArgIleProLeuSerGl : 99 ::||| :::::: 2145 bp |||||||||||||||!! heGluThrIleGln++ ++ArgIleProLeuSerAs 17841 : ttgagaccatccaggt.........................agAGAATTCCATTGAGTGA : 20015 100 : uMetThrArgGluGluIleAsnAlaLeuValGlnGluLeuGlyPheTyrArgLysAlaAl : 119 :||||||||||||||||||||| !|||||||||!!:||||||||||||||||||! !:! pMetThrArgGluGluIleAsnGlnLeuValGlnAspLeuGlyPheTyrArgLysGluSe 20016 : CATGACCCGGGAAGAGATCAACCAGCTTGTGCAGGACTTGGGGTTCTACCGGAAGGAGTC : 20075 120 : aProAspAlaGlnValProProGluTyrValTrpAlaProAlaLysPro : 135 !||||||:!!! !|||||| !|||!:! ! !|||||||||::!||| rProAspSerProValProGluGluPheHisLeuAlaProAlaArgPro 20076 : GCCTGACTCGCCAGTACCTGAAGAGTTCCATCTGGCCCCTGCTCGGCCC : 20125 vulgar: SPP00000077_2.0 0 135 . KQ753014.1:subseq(74829,40125) 11152 20125 + 211 M 27 81 G 2 0 M 14 42 5 0 2 I 0 4503 3 0 2 M 19 57 S 0 2 5 0 2 I 0 945 3 0 2 S 1 1 M 24 72 S 0 1 5 0 2 I 0 969 3 0 2 S 1 2 M 5 15 5 0 2 I 0 2141 3 0 2 M 42 126 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-12-02 ##type DNA # # # seqname source feature start end score strand frame attributes # KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local gene 11153 20125 211 + . gene_id 1 ; sequence SPP00000077_2.0 ; gene_orientation + KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local cds 11153 11275 . + . KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local exon 11153 11275 . + . insertions 0 ; deletions 2 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice5 11276 11277 . + . intron_id 1 ; splice_site "GT" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local intron 11276 15782 . + . intron_id 1 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice3 15781 15782 . + . intron_id 0 ; splice_site "AG" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local cds 15783 15841 . + . KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local exon 15783 15841 . + . insertions 0 ; deletions 0 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice5 15842 15843 . + . intron_id 2 ; splice_site "GT" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local intron 15842 16790 . + . intron_id 2 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice3 16789 16790 . + . intron_id 1 ; splice_site "AG" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local cds 16791 16864 . + . KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local exon 16791 16864 . + . insertions 0 ; deletions 0 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice5 16865 16866 . + . intron_id 3 ; splice_site "AT" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local intron 16865 17837 . + . intron_id 3 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice3 17836 17837 . + . intron_id 2 ; splice_site "ag" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local cds 17838 17854 . + . KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local exon 17838 17854 . + . insertions 0 ; deletions 0 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice5 17855 17856 . + . intron_id 4 ; splice_site "gt" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local intron 17855 19999 . + . intron_id 4 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local splice3 19998 19999 . + . intron_id 3 ; splice_site "AG" KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local cds 20000 20125 . + . KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local exon 20000 20125 . + . insertions 0 ; deletions 0 KQ753014.1:subseq(74829,40125) exonerate:protein2genome:local similarity 11153 20125 211 + . alignment_id 1 ; Query SPP00000077_2.0 ; Align 11153 1 81 ; Align 11234 30 42 ; Align 15783 44 57 ; Align 16792 64 72 ; Align 17840 89 15 ; Align 20000 94 126 # --- END OF GFF DUMP --- # -- completed exonerate analysis