Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q SELENOI.anole.fa -t SELENOI.extraccio.KQ751719.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000211_2.0 # Protein # Selenoprotein I (SELENOI) # Anole lizard Target: KQ751719.1:subseq(531184,52423) Gekko japonicus isolate JY-2015 unplaced genomic scaffold scaffold63, whole genome shotgun sequence Model: protein2genome:local Raw score: 829 Query range: 13 -> 203 Target range: 14659 -> 32423 14 : PheLeuSerPhePheLeuSerPhePheLeuSerPhePheLeuSerPhePheLeuSerPhe : 33 |||! !.!!|||.!.||| ! !!||| !! !|||.!!:!!:!!!:!||| ! !! ! PheSerGlyPheLeuLeuLeuValPheAsnPhePheLeuMetAlaTyrPheAspProAsp 14660 : TTTTCTGGCTTCCTGCTGCTTGTCTTCAACTTCTTCCTCATGGCATATTTTGATCCTGAC : 14717 34 : PheProProSer{A} >>>> Target Intron 1 >>>> {la}ProAspGlnGlu : 42 ||| ! !!|||{|} 5271 bp {||}||||||!!.! PheTyrAlaSer{A}++ ++{la}ProAspHisVal 14718 : TTTTATGCATCT{G}gt.........................ag{CA}CCTGATCATGTC : 20015 43 : HisValProAsnAlaIleTrpValValValGlyLeuLeuAsnPheMetAlaTyrThrLeu : 62 |||||||||||| !:!:||||||:!!||||||||||||||||||!!:|||||||||||| HisValProAsnLysLeuTrpValIleValGlyLeuLeuAsnPheIleAlaTyrThrLeu 20016 : CATGTTCCCAACAAACTGTGGGTCATAGTGGGCCTTCTCAATTTCATCGCTTACACGCTA : 20075 63 : {A} >>>> Target Intron 2 >>>> {sp}GlyValAspGlyLysGlnAlaArg : 71 {|} 638 bp {||}|||||||||||||||||||||||| {A}++ ++{sp}GlyValAspGlyLysGlnAlaArg 20076 : {G}gt.........................ag{AT}GGCGTGGACGGGAAGCAGGCTCGC : 20740 72 : ArgThrGlnSerSerThrProLeuGlyGluLeuPheAspHisGlyLeuAspSerTrpAla : 91 ||||||:!!||||||||||||||||||||||||||||||||||||||||||||||||||| ArgThrLysSerSerThrProLeuGlyGluLeuPheAspHisGlyLeuAspSerTrpAla 20741 : CGGACCAAATCCAGCACCCCGCTTGGCGAGCTCTTTGACCATGGCCTGGACAGCTGGGCT : 20800 92 : CysMetPhePheValValThrValTyrSerThrPheGlyArgGlyProAsnGlyValSer : 111 ||||||||||||||||||||||||||||||||||||||||||||| !!|||||||||||| CysMetPhePheValValThrValTyrSerThrPheGlyArgGlySerAsnGlyValSer 20801 : TGTATGTTCTTCGTGGTGACGGTGTATTCCACCTTTGGCCGGGGATCCAATGGTGTCAGT : 20860 112 : ValPheValLeuTyrLeuLeuLeuTrpValValLeuPheSerPheIleLeuSerHisTrp : 131 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ValPheValLeuTyrLeuLeuLeuTrpValValLeuPheSerPheIleLeuSerHisTrp 20861 : GTCTTTGTCCTCTACCTCCTCCTGTGGGTGGTTTTGTTCTCCTTTATCCTCTCCCACTGG : 20920 132 : GluLysTyrAsnThrGlyIleLeuPheLeuProTrpGlyTyrAspIleSerGlnVal > : 151 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GluLysTyrAsnThrGlyIleLeuPheLeuProTrpGlyTyrAspIleSerGlnVal++ 20921 : GAGAAATATAACACAGGGATTCTCTTCCTGCCATGGGGATACGACATAAGCCAGGTGgt. : 20982 152 : >>> Target Intron 3 >>>> ThrIleThrIleValTyrIleValThrSerIleV : 162 6073 bp ||||||:!!||||||||||||||||||||||||| ++ThrIleSerIleValTyrIleValThrSerIleV 20983 : ........................agACCATTTCGATTGTGTACATAGTGACCTCGATTG : 27086 163 : alGlyValGluAlaTrpTyrAsnProPheLeuPheAsnPhePheTyrArgAspLeuPheV : 182 ||||||||||||||||||||!..|||||||||||||||.!!!!.|||||||||||||||. alGlyValGluAlaTrpTyrArgProPheLeuPheAsnIleLeuTyrArgAspLeuPheT 27087 : TGGGAGTGGAGGCCTGGTACAGACCTTTCCTGTTTAATATCTTATATAGAGACCTATTCA : 27146 183 : alAlaMetIleVal{G} >>>> Target Intron 4 >>>> {ly}CysGlyLeuT : 191 .!.!!|||||||||{|} 5212 bp {||}|||!.!|||| hrThrMetIleVal{G}++ ++{ly}CysAlaLeuT 27147 : CTACAATGATTGTC{G}gt.........................ag{GT}TGTGCGCTCA : 32385 192 : hrValThrValProMetSerLeuLeuAsnTyrTyrLys : 203 ||||||||:!!||||||||||||! !|||||||||||| hrValThrLeuProMetSerLeuArgAsnTyrTyrLys 32386 : CTGTGACCCTTCCCATGAGCCTGCGTAATTACTACAAG : 32423 vulgar: SPP00000211_2.0 13 203 . KQ751719.1:subseq(531184,52423) 14659 32423 + 829 M 24 72 S 0 1 5 0 2 I 0 5267 3 0 2 S 1 2 M 24 72 S 0 1 5 0 2 I 0 634 3 0 2 S 1 2 M 87 261 5 0 2 I 0 6069 3 0 2 M 36 108 S 0 1 5 0 2 I 0 5208 3 0 2 S 1 2 M 16 48 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-10 ##type DNA # # # seqname source feature start end score strand frame attributes # KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local gene 14660 32423 829 + . gene_id 1 ; sequence SPP00000211_2.0 ; gene_orientation + KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local cds 14660 14732 . + . KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local exon 14660 14732 . + . insertions 0 ; deletions 0 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice5 14733 14734 . + . intron_id 1 ; splice_site "GT" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local intron 14733 20003 . + . intron_id 1 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice3 20002 20003 . + . intron_id 0 ; splice_site "AG" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local cds 20004 20078 . + . KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local exon 20004 20078 . + . insertions 0 ; deletions 0 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice5 20079 20080 . + . intron_id 2 ; splice_site "GT" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local intron 20079 20716 . + . intron_id 2 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice3 20715 20716 . + . intron_id 1 ; splice_site "AG" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local cds 20717 20979 . + . KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local exon 20717 20979 . + . insertions 0 ; deletions 0 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice5 20980 20981 . + . intron_id 3 ; splice_site "GT" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local intron 20980 27052 . + . intron_id 3 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice3 27051 27052 . + . intron_id 2 ; splice_site "AG" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local cds 27053 27161 . + . KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local exon 27053 27161 . + . insertions 0 ; deletions 0 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice5 27162 27163 . + . intron_id 4 ; splice_site "GT" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local intron 27162 32373 . + . intron_id 4 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local splice3 32372 32373 . + . intron_id 3 ; splice_site "AG" KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local cds 32374 32423 . + . KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local exon 32374 32423 . + . insertions 0 ; deletions 0 KQ751719.1:subseq(531184,52423) exonerate:protein2genome:local similarity 14660 32423 829 + . alignment_id 1 ; Query SPP00000211_2.0 ; Align 14660 14 72 ; Align 20006 39 72 ; Align 20719 64 261 ; Align 27053 151 108 ; Align 32376 188 48 # --- END OF GFF DUMP --- # -- completed exonerate analysis