Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q SECS.anole.fa -t SECS.extraccio.KQ752578.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000207_2.0 # Protein # Selenocysteine synthase (SecS) # Anole lizard Target: KQ752578.1:subseq(1980023,96227) Gekko japonicus isolate JY-2015 unplaced genomic scaffold scaffold56, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 1994 Query range: 20 -> 466 Target range: 91976 -> 19999 21 : GlySerGlnGlyArgArgAlaHisGlu >>>> Target Intron 1 >>>> LeuA : 31 ||||||||| |||::: ::: 9954 bp GlySerGlnArgAlaArgSerSerGln++ ++ProS 91976 : gggtcacaaagagcaagaagcagccaggt.........................agccct : 81992 32 : rgLeuArgAlaLeuLeuGluGln >>>> Target Intron 2 >>>> GlyLysCy : 41 :::|||||| ...||| 5744 bp |||||||| erValArgAlaArgSerSerGln++ ++GlyLysCy 81991 : cagtcagagcaagaagcagccaggt.........................agGGCAAATG : 76218 42 : sProGluAspGlyTrpAspGluSerThrIleGluLeuPheLeuHisGluLeuAlaIleMe : 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| sProGluAspGlyTrpAspGluSerThrIleGluLeuPheLeuHisGluLeuAlaIleMe 76217 : TCCCGAAGATGGATGGGATGAAAGTACCATTGAGCTCTTTCTTCATGAACTTGCCATCAT : 76158 62 : tAspSerAsnAsnPheLeuGlyAsnCysGlyValGlyGluArgGluGlyArgValAlaSe : 81 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| tAspSerAsnAsnPheLeuGlyAsnCysGlyValGlyGluArgGluGlyArgValAlaSe 76157 : GGACAGCAACAACTTCCTGGGCAACTGCGGTGTGggtgagagggaaggaagagtGGCATC : 76098 82 : rGlyLeuValAlaArgArgHisTyr{Ar} >>>> Target Intron 3 >>>> {g : 90 |||||||||||||||||||||||||{||} 7696 bp {| rGlyLeuValAlaArgArgHisTyr{Ar}++ ++{g 76097 : GGGGCTAGTAGCCCGCCGGCATTAC{AG}gt.........................ag{G : 68373 91 : }LeuIleHisGlyIleGlyArgSerGlyAspIleSerAlaValGlnProLysAlaAlaGl : 110 }|||||||||||||||||||||||||||||||||:!!||||||||||||||||||||||| }LeuIleHisGlyIleGlyArgSerGlyAspIleAlaAlaValGlnProLysAlaAlaGl 68372 : }TTGATCCACGGGATCGGAAGGTCAGGCGACATCGCTGCCGTCCAACCGAAAGCCGCCGG : 68315 111 : ySerSerLeuLeuAsnLysLeuThrAsnSerLeuValLeuAspIleIleLysLeuAla{G : 130 |||||||||||||||||||||||||||||||:!!|||||||||||||||!:!||||||{| ySerSerLeuLeuAsnLysLeuThrAsnSerIleValLeuAspIleIleArgLeuAla{G 68314 : CTCCAgcctcttgaacaaacttacaaACTCCATTGTCTTGGATATTATAAGACTTGCC{G : 68255 131 : } >>>> Target Intron 4 >>>> {ly}ValLysThrAlaAsnSerCysPheVa : 139 } 494 bp {||}|||::!||||||!:!||||||||||| }++ ++{ly}ValArgThrAlaSerSerCysPheVa 68254 : }gt.........................ag{GA}GTCCGGACGGCGAGCAGCTGCTTTGT : 67734 140 : lValProMetAlaThrGlyMetSerLeuThrLeuCysPheLeuThrLeuArgHisLysAr : 159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||!:!|| lValProMetAlaThrGlyMetSerLeuThrLeuCysPheLeuThrLeuArgHisArgAr 67733 : GGTCCCCATGGCAACAGGCATGAGTCTCACCTTGTGCTTCTTGACCCTGCGGCACAGGAG : 67674 160 : gProGlnAlaLysTyrIleIleTrpProArgIleAspGlnLysSerCysPheLysSerMe : 179 ||||:!!||||||||||||:!!|||||||||||||||||||||||||||||||||||||| gProLysAlaLysTyrIleLeuTrpProArgIleAspGlnLysSerCysPheLysSerMe 67673 : ACCAAAGGCCAAGTACATCCTTTGGCCACGCATAGACCAGAAGTCCTGCTTCAAGTCCAT : 67614 180 : tIleThrGly{G} >>>> Target Intron 5 >>>> {ly}PheGluProValVa : 188 |||||||!.!{|} 6242 bp {||}|||||||||||||| tIleThrAla{G}++ ++{ly}PheGluProValVa 67613 : GATCACTGCA{G}gt.........................ag{GT}TTTGAGCCGGTGGT : 61345 189 : lIleGluAsnValLeuGluGlyAspGluLeuArgThrAspLeuLysAlaValGluAlaLy : 208 ||||||||||||||||||||||||||||||||||||||||||| !|||||||||.!!|| lIleGluAsnValLeuGluGlyAspGluLeuArgThrAspLeuValAlaValGluThrLy 61344 : GATAGAAAACGTGTTAGAAGGTGATGAGCTGCGTACAGATCTCGTGGCAGTGGAGACTAA : 61285 209 : sIleGlnAspLeuGlyAlaAspAsnIleLeuCysValHisSerThrThrSerCysPheAl : 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| sIleGlnAspLeuGlyAlaAspAsnIleLeuCysValHisSerThrThrSerCysPheAl 61284 : AATCCAGGATCTTGGGGCTGATAATATTCTCTGTGttcattctaccacatcatgttTTGC : 61225 229 : aProArgValProAsp{Ar} >>>> Target Intron 6 >>>> {g}LeuGluGl : 237 ||||||||||||||||{||} 17229 bp {|}|||||||| aProArgValProAsp{Ar}++ ++{g}LeuGluGl 61224 : TCCAAGGGTGCCTGAC{AG}gt.........................ag{A}CTGGAAGA : 43969 238 : uLeuAlaGluIleCysAlaLysTyrAspIleProHisIleValAsnAsnAlaTyrGlyVa : 257 ||||||||||||||||.!!|||:!!||||||||||||||||||||||||||||||||||| uLeuAlaGluIleCysThrLysHisAspIleProHisIleValAsnAsnAlaTyrGlyVa 43968 : ACTGGCAGAGATTTGCACGAAGCACGACATCCCTCACATTGTCAACAACGCGTATGGAGT : 43909 258 : lGlnSerSerLysCysMetHisLeuIleGlnGln >>>> Target Intron 7 >>> : 269 |||||||||||||||||||||||||||||||||| 9821 bp lGlnSerSerLysCysMetHisLeuIleGlnGln++ 43908 : CCAGTCCTCCAAGTGCATGCACCTCATTCAGCAGgt........................ : 43871 270 : > GlyAlaArgArgGlyArgIleAspAlaPheValGlnSerLeuAspLysAsnPheMet : 287 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ++GlyAlaArgArgGlyArgIleAspAlaPheValGlnSerLeuAspLysAsnPheMet 43870 : .agGGAGCGCGAAGAGGCCGGATAGATGCTTTTGTGCAGAGCCTGGACAAAAATTTTATG : 33998 288 : ValProValGlyGlyAlaIleIleAlaGlyPheAsnAspSerPheIleGlnGluIleSer : 307 ||||||:!!|||||||||:!!||||||||||||!:!|||:!!|||:!!|||||||||||| ValProIleGlyGlyAlaValIleAlaGlyPheSerAspAlaPheValGlnGluIleSer 33997 : GTTCCTATAGGTGGCGCTGTCATTGCTGGCTTCAGTGACGCCTTCGTCCAGGAGATCAGC : 33938 308 : LysMetTyrPro{G} >>>> Target Intron 8 >>>> {ly}ArgAlaSerAla : 316 ||||||||||||{|} 140 bp {||} !!||||||||| LysMetTyrPro{G}++ -+{ly}GlyAlaSerAla 33937 : AAAATGTACCCA{G}gt.........................gg{GA}GGAGCGTCCGCC : 33771 317 : SerProSerLeuAspValLeuIleThrLeuLeuThrLeuGlyThrLysGlyTyrGlnArg : 336 |||||||||||||||||||||||||||||||||:!!|||||||||||||||||||||!:! SerProSerLeuAspValLeuIleThrLeuLeuSerLeuGlyThrLysGlyTyrGlnGln 33770 : TCCCCTTCGTTAGATGTTCTCATTACCTTGCTGTCCTTGGGCACAAAGGGGTACCAGCAG : 33711 337 : LeuLeuLysGluArgLys >>>> Target Intron 9 >>>> GluMetPheSerT : 347 |||||||||||||||||| 10674 bp ||||||||||||| LeuLeuLysGluArgLys++ ++GluMetPheSerT 33710 : CTGCTGAAAGAACGAAAGgt.........................aggaaATGTTTTCCT : 23004 348 : yrLeuSerSerGluMetLysLysLeuAlaGluAlaTyrAsnGluArgLeuLeuAspThrP : 367 ||||||||||||||:!!|||!!.|||||||||||||||!:!||||||||||||!!:|||| yrLeuSerSerGluLeuLysAsnLeuAlaGluAlaTyrSerGluArgLeuLeuGluThrP 23003 : ATCTTTCAAGTGAGCTGAAGAACTTAGCGGAAGCCTACAGTGAAAGACTGCTGGAGACGC : 22944 368 : roHisAsnProIleSerLeu{A} >>>> Target Intron 10 >>>> {la}Met : 375 ||||||||||||||||||||{|} 1561 bp {||}||| roHisAsnProIleSerLeu{A}++ ++{la}Met 22943 : CTCACAACCCTATTTCCTTA{G}gt..........................ag{CG}ATG : 21359 376 : SerLeuLysGluLeuSerGluGlnAsnGlyThrAlaValThrGlnLeuGlySerMetLeu : 395 |||||||||:!!|||..!|||||||||.!!|||||||||||||||||||||||||||||| SerLeuLysLysLeuAspGluGlnAsnSerThrAlaValThrGlnLeuGlySerMetLeu 21358 : TCCTTGAAGAAGCTAGATGAACAAAACAGTACAGCAGTTACACAGCTTGGATCGATGCTT : 21299 396 : PheThrArgGlnValSerGlyAla{Ar} >>>> Target Intron 11 >>>> {g : 404 ||||||||||||||||||||||||{||} 1084 bp {| PheThrArgGlnValSerGlyAla{Ar}+- ++{g 21298 : TTCACAAGACAAGTTTCTGGAGCA{AG}gc..........................ag{G : 20186 405 : }ValValProLeuGlyThrValGlnThrValSerGlyTyrThrPheGluGlyPheMetAl : 424 }|||||||||||||||:!!:!!||||||||||||||||||.!!|||:!!|||||||||:! }ValValProLeuGlySerLeuGlnThrValSerGlyTyrAlaPheLysGlyPheMetSe 20185 : }GTGGTTCCCCTTGGTTCTCTGCAAACCGTGAGCGGCTACGCTTTCAAAGGCTTCATGTC : 20128 425 : aHisThrAsnLysTyrProCysAlaTyrLeuAsnAlaAlaSerAlaIleGlyIleThrLy : 444 !||||||:!!!..|||||||||||||||||||||||||||||||||||||||!!::!!|| rHisThrAspSerTyrProCysAlaTyrLeuAsnAlaAlaSerAlaIleGlyMetSerLy 20127 : ACATACCGACAGCTACCCCTGCGCATACCTCAACGCTGCGTCCGCCATTGGAATGTCCAA : 20068 445 : sGluAspValAspValPheLeuLysArgLeuAspLysCysLeuLysAlaLeuArgLysGl : 464 |:!!||||||||||||||||||||||||||||||||||||||||||.!!||| !||||| sGlnAspValAspValPheLeuLysArgLeuAspLysCysLeuLysThrLeuAlaLysGl 20067 : ACAAGACGTAGATGTGTTCTTGAAAAGGCTTGACAAGTGTTTAAAGACTCTAGCGAAAGG : 20008 465 : yLysAsp : 466 ||||:!! yLysAsn 20007 : AAAGAAC : 20000 vulgar: SPP00000207_2.0 20 466 . KQ752578.1:subseq(1980023,96227) 91976 19999 - 1994 M 9 27 5 0 2 I 0 9950 3 0 2 M 9 27 5 0 2 I 0 5740 3 0 2 M 51 153 S 0 2 5 0 2 I 0 7692 3 0 2 S 1 1 M 39 117 S 0 1 5 0 2 I 0 490 3 0 2 S 1 2 M 52 156 S 0 1 5 0 2 I 0 6238 3 0 2 S 1 2 M 50 150 S 0 2 5 0 2 I 0 17225 3 0 2 S 1 1 M 34 102 5 0 2 I 0 9817 3 0 2 M 43 129 S 0 1 5 0 2 I 0 136 3 0 2 S 1 2 M 30 90 5 0 2 I 0 10670 3 0 2 M 31 93 S 0 1 5 0 2 I 0 1557 3 0 2 S 1 2 M 29 87 S 0 2 5 0 2 I 0 1080 3 0 2 S 1 1 M 62 186 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-10 ##type DNA # # # seqname source feature start end score strand frame attributes # KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local gene 20000 91976 1994 - . gene_id 1 ; sequence SPP00000207_2.0 ; gene_orientation + KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 91950 91976 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 91950 91976 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 91948 91949 . - . intron_id 1 ; splice_site "gt" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 81996 91949 . - . intron_id 1 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 81996 81997 . - . intron_id 0 ; splice_site "ag" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 81969 81995 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 81969 81995 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 81967 81968 . - . intron_id 2 ; splice_site "gt" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 76225 81968 . - . intron_id 2 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 76225 76226 . - . intron_id 1 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 76070 76224 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 76070 76224 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 76068 76069 . - . intron_id 3 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 68374 76069 . - . intron_id 3 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 68374 68375 . - . intron_id 2 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 68255 68373 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 68255 68373 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 68253 68254 . - . intron_id 4 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 67761 68254 . - . intron_id 4 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 67761 67762 . - . intron_id 3 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 67602 67760 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 67602 67760 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 67600 67601 . - . intron_id 5 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 61360 67601 . - . intron_id 5 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 61360 61361 . - . intron_id 4 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 61206 61359 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 61206 61359 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 61204 61205 . - . intron_id 6 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 43977 61205 . - . intron_id 6 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 43977 43978 . - . intron_id 5 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 43874 43976 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 43874 43976 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 43872 43873 . - . intron_id 7 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 34053 43873 . - . intron_id 7 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 34053 34054 . - . intron_id 6 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 33923 34052 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 33923 34052 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 33921 33922 . - . intron_id 8 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 33783 33922 . - . intron_id 8 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 33783 33784 . - . intron_id 7 ; splice_site "gg" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 33691 33782 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 33691 33782 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 33689 33690 . - . intron_id 9 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 23017 33690 . - . intron_id 9 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 23017 23018 . - . intron_id 8 ; splice_site "ag" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 22923 23016 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 22923 23016 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 22921 22922 . - . intron_id 10 ; splice_site "GT" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 21362 22922 . - . intron_id 10 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 21362 21363 . - . intron_id 9 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 21271 21361 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 21271 21361 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice5 21269 21270 . - . intron_id 11 ; splice_site "GC" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local intron 20187 21270 . - . intron_id 11 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local splice3 20187 20188 . - . intron_id 10 ; splice_site "AG" KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local cds 20000 20186 . - . KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local exon 20000 20186 . - . insertions 0 ; deletions 0 KQ752578.1:subseq(1980023,96227) exonerate:protein2genome:local similarity 20000 91976 1994 - . alignment_id 1 ; Query SPP00000207_2.0 ; Align 91977 21 27 ; Align 81996 30 27 ; Align 76225 39 153 ; Align 68373 91 117 ; Align 67759 131 156 ; Align 61358 184 150 ; Align 43976 235 102 ; Align 34053 269 129 ; Align 33781 313 90 ; Align 23017 343 93 ; Align 21360 375 87 ; Align 20186 405 186 # --- END OF GFF DUMP --- # -- completed exonerate analysis