Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q MSRB1.anole.fa -t MSRB1.extraccio.KQ751406.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000219_2.0 # Protein # Methionine-R-sufoxide reductase 1 (MSRB1) # Anole lizard Target: KQ751406.1:subseq(83443,40431) Gekko japonicus isolate JY-2015 unplaced genomic scaffold scaffold3333, whole genome shotgun sequence Model: protein2genome:local Raw score: 424 Query range: 1 -> 94 Target range: 2042 -> 24732 2 : ProAla{G} >>>> Target Intron 1 >>>> {ly}MetTyrValCysSerLys : 10 ||||||{|} 17954 bp {||}!!:|||||||||:!!!:! ProAla{G}++ ++{ly}IleTyrValCysAlaArg 2043 : cccgcc{g}gt.........................ag{GG}ATCTACGTTTGCGCCAGA : 20021 11 : CysGlyPheGluLeuPheSerSerLysSerLysTyrAlaHisSerSerProTrpProAla : 30 ||||||!:!||||||||||||||||||!!!|||||||||||||||||||||||||||||| CysGlyTyrGluLeuPheSerSerLysThrLysTyrAlaHisSerSerProTrpProAla 20022 : TGCGGCTACGAACTCTTTTCCAGCAAAACAAAATACGCCCATTCGTCCCCATGGCCGGCG : 20081 31 : PheThrGluThrIleHisAspAspSerIleThrLysTyrLeuGluArgProAsnAlaPhe : 50 |||||||||||||||||| !||||||:!!:!!|||||| !|||||||||..!|||!!. PheThrGluThrIleHisIleAspSerValSerLysTyrGluGluArgProGlyAlaLeu 20082 : TTCACCGAAACCATCCACATCGACAGCGTCTCCAAATACGAAGAGCGCCCAGGTGCCTTG : 20141 51 : Lys >>>> Target Intron 2 >>>> ValLeuCysGlyLysCysGlyAsnGlyL : 61 ||| 165 bp ||||||||||||||||||||||||.!!| Lys++ ++ValLeuCysGlyLysCysGlyAsnSerL 20142 : AAGgt.........................agGTGCTCTGCGGGAAGTGTGGCAACAGTC : 20339 62 : euGlyHisGluPheIleAsnAspGlyProLysLysGlyGlnSerArgPheUnkIlePheS : 81 ||||||||||||||:!!||||||||||||||||||||||||||||||||| ||||||| euGlyHisGluPheLeuAsnAspGlyProLysLysGlyGlnSerArgPhe***IlePheS 20340 : TGGGCCATGAATTTCTCAACGACGGCCCAAAGAAGGGTCAGTCTCGCTTCTGAATATTCA : 20399 82 : erSerSerLeuLysPheValProLys{G} >>>> Target Intron 3 >>>> {l : 90 ||||||||||||||||||||||||||{|} 4292 bp {| erSerSerLeuLysPheValProLys{G}++ ++{l 20400 : GCAGCTCTCTCAAGTTCGTCCCTAAA{G}gt.........................ag{G : 24719 91 : y}GluProAlaSer : 94 |}:!! !!|||||| y}GlnAlaAlaSer 24720 : A}CAAGCTGCCTCT : 24732 vulgar: SPP00000219_2.0 1 94 . KQ751406.1:subseq(83443,40431) 2042 24732 + 424 M 2 6 S 0 1 5 0 2 I 0 17950 3 0 2 S 1 2 M 47 141 5 0 2 I 0 161 3 0 2 M 38 114 S 0 1 5 0 2 I 0 4288 3 0 2 S 1 2 M 4 12 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-09 ##type DNA # # # seqname source feature start end score strand frame attributes # KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local gene 2043 24732 424 + . gene_id 1 ; sequence SPP00000219_2.0 ; gene_orientation + KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local cds 2043 2049 . + . KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local exon 2043 2049 . + . insertions 0 ; deletions 0 KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local splice5 2050 2051 . + . intron_id 1 ; splice_site "gt" KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local intron 2050 20003 . + . intron_id 1 KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local splice3 20002 20003 . + . intron_id 0 ; splice_site "AG" KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local cds 20004 20146 . + . KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local exon 20004 20146 . + . insertions 0 ; deletions 0 KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local splice5 20147 20148 . + . intron_id 2 ; splice_site "GT" KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local intron 20147 20311 . + . intron_id 2 KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local splice3 20310 20311 . + . intron_id 1 ; splice_site "AG" KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local cds 20312 20426 . + . KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local exon 20312 20426 . + . insertions 0 ; deletions 0 KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local splice5 20427 20428 . + . intron_id 3 ; splice_site "GT" KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local intron 20427 24718 . + . intron_id 3 KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local splice3 24717 24718 . + . intron_id 2 ; splice_site "AG" KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local cds 24719 24732 . + . KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local exon 24719 24732 . + . insertions 0 ; deletions 0 KQ751406.1:subseq(83443,40431) exonerate:protein2genome:local similarity 2043 24732 424 + . alignment_id 1 ; Query SPP00000219_2.0 ; Align 2043 2 6 ; Align 20006 5 141 ; Align 20312 52 114 ; Align 24721 91 12 # --- END OF GFF DUMP --- # -- completed exonerate analysis