Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q GPx4.anole.fa -t GPx4.extraccio.KQ747986.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SPP00000026_2.0 # Protein # Glutathione peroxidase 4 (GPx4) # Human Target: KQ747986.1:subseq(139499,45488) Gekko japonicus isolate JY-2015 unplaced genomic scaffold scaffold1442, whole genome shotgun sequence Model: protein2genome:local Raw score: 734 Query range: 8 -> 196 Target range: 11222 -> 27336 9 : LeuLeuLysProAlaLeuLeuCysGlyAlaLeuAlaAlaProGlyLeuAlaGlyThrMet : 28 |||:!!::! !.!!||||||||||||!.!|||.!!|||! !||||||.!! !!|||||| LeuValArgArgThrLeuLeuCysGlyValLeuThrAlaArgGlyLeuThrArgThrMet 11223 : TTAGTGCGGAGGACGTTGCTGTGTGGAGTGTTGACGGCGCGGGGGCTGACGCGGACCATG : 11280 29 : >>>> Target Intron 1 >>>> CysAlaSerArgAspAspTrpArgCysAlaA : 39 8717 bp ||||||.....!! !||||||||| !|||! ++ ++CysAlaGlnGluValAspTrpArgThrAlaL 11281 : gt.........................agtgtgcccaaGAAGTTGACTGGAGAACTGCCA : 20030 40 : rgSerMetHisGluPheSerAlaLysAspIleAspGlyHisMetValAsnLeuAspLysT : 59 :!|||!!::!!!!:||| !|||! !||||||||||||:!! |||:::|||!!:|||| ysSerIleTyrAspPheHisAlaThrAspIleAspGlyAsnAspValSerLeuGluLysT 20031 : AATCCATCTATGACTTCCACGCCACAGATATCGATGGCAATGACGTCTCACTGGAGAAAT : 20090 60 : yr{Ar} >>>> Target Intron 2 >>>> {g}GlyPheValCysIleValThrA : 68 ||{||} 1140 bp {|}||| !|||||||||:!!|||| yr{Ar}++ ++{g}GlyHisValCysIleIleThrA 20091 : AC{AG}gt.........................ag{g}ggTCACGTCTGCATCATCACCA : 21257 69 : snValAlaSerGlnUnkGlyLysThrGluValAsnTyrThrGlnLeuValAspLeuHisA : 88 |||||||||||:!! |||||||||! |||||||||||||||!!!||||||:!!:!!! snValAlaSerLys***GlyLysThrGlyValAsnTyrThrGlnPheValAspMetTyrG 21258 : ACGTCGCCTCCAAATGAGGCAAGACGGGCGTAAACTACACTCAGTTTGTCGACATGTACG : 21317 89 : laArgTyrAlaGluCysGlyLeuArgIleLeuAlaPheProCysAsnGlnPheGlyLysG : 108 .!|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| lyArgTyrAlaGluLysGlyLeuArgIleLeuAlaPheProCysAsnGlnPheGlyLysG 21318 : GCCGATACGCTGAGAAGGGTTTACGCATCCTGGCCTTCCCTTGCAACCAGTTCGGCAAGC : 21377 109 : ln >>>> Target Intron 3 >>>> GluProGlySerAsnGluGluIleLysGl : 118 || 95 bp |||||||||!!!:!!! !|||||||||! ln++ ++GluProGlyThrAspAlaGluIleLysAl 21378 : AGgt.........................agGAGCCAGGCACCGACGCGGAGATCAAAGC : 21502 119 : uPheAlaAlaGlyTyrAsnValLysPheAspMetPheSerLysIleCysValAsnGlyAs : 138 |||||||||||||||...||||||||||||||||||||||||||| !||||||||||| aPheAlaAlaGlyTyrGlyValLysPheAspMetPheSerLysIleAspValAsnGlyAs 21503 : CTTTGCCGCAGGCTACGGGGTGAAGTTCGACATGTTCAGCAAAATCGACGTGAACGGCGA : 21562 139 : pAspAlaHisProLeuTrpLysTrpMetLysIleGlnProLysGlyLysGlyIleLeuGl : 158 |||||||||||||||||||||||||||||||! !||||||||||||!:!|||! !||||| pAspAlaHisProLeuTrpLysTrpMetLysSerGlnProLysGlyArgGlyThrLeuGl 21563 : CGACGCCCACCCGCTCTGGAAGTGGATGAAGAGCCAGCCCAAGGGGAGAGGCACCCTGGG : 21622 159 : y{As} >>>> Target Intron 4 >>>> {n}AlaIleLysTrpAsnPheThrLy : 167 |{||} 1157 bp {|}||||||||||||||||||!:!|| y{As}++ ++{n}AlaIleLysTrpAsnPheSerLy 21623 : A{AA}gt.........................ag{T}GCCATTAAATGGAACTTCAGCAA : 22806 168 : s >>>> Target Intron 5 >>>> PheLeuIleAspLysAsnGlyCysValVal : 177 | 2617 bp |||||||||:!!|||.!.||| |||||| s++ ++PheLeuIleAsnLysGluGlyGlnValVal 22807 : Ggt.........................agttcCTCATCAACAAAGAAGGCCAGGTGGTC : 25453 178 : LysArgTyrGlyProMetGluGluProLeu >>>> Target Intron 6 >>>> V : 188 |||||||||.!!||||||!!:!!:|||:!! 1824 bp | LysArgTyrSerProMetAspAspProVal++ ++V 25454 : AAGAGGTACAGTCCAATGGACGACCCCGTGgt.........................agG : 27310 189 : alIleGluLysAspLeuProHisTyr : 196 |||||||||||||||||||| !!:! alIleGluLysAspLeuProThrPhe 27311 : TGATCGAGAAGGACCTGCCCACCTTC : 27336 vulgar: SPP00000026_2.0 8 196 . KQ747986.1:subseq(139499,45488) 11222 27336 + 734 M 20 60 5 0 2 I 0 8713 3 0 2 M 31 93 S 0 2 5 0 2 I 0 1136 3 0 2 S 1 1 M 48 144 5 0 2 I 0 91 3 0 2 M 50 150 S 0 2 5 0 2 I 0 1153 3 0 2 S 1 1 M 8 24 5 0 2 I 0 2613 3 0 2 M 20 60 5 0 2 I 0 1820 3 0 2 M 9 27 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-12-01 ##type DNA # # # seqname source feature start end score strand frame attributes # KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local gene 11223 27336 734 + . gene_id 1 ; sequence SPP00000026_2.0 ; gene_orientation + KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local cds 11223 11282 . + . KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local exon 11223 11282 . + . insertions 0 ; deletions 0 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice5 11283 11284 . + . intron_id 1 ; splice_site "GT" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local intron 11283 19999 . + . intron_id 1 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice3 19998 19999 . + . intron_id 0 ; splice_site "ag" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local cds 20000 20094 . + . KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local exon 20000 20094 . + . insertions 0 ; deletions 0 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice5 20095 20096 . + . intron_id 2 ; splice_site "GT" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local intron 20095 21234 . + . intron_id 2 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice3 21233 21234 . + . intron_id 1 ; splice_site "ag" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local cds 21235 21379 . + . KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local exon 21235 21379 . + . insertions 0 ; deletions 0 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice5 21380 21381 . + . intron_id 3 ; splice_site "GT" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local intron 21380 21474 . + . intron_id 3 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice3 21473 21474 . + . intron_id 2 ; splice_site "AG" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local cds 21475 21626 . + . KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local exon 21475 21626 . + . insertions 0 ; deletions 0 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice5 21627 21628 . + . intron_id 4 ; splice_site "GT" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local intron 21627 22783 . + . intron_id 4 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice3 22782 22783 . + . intron_id 3 ; splice_site "aG" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local cds 22784 22808 . + . KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local exon 22784 22808 . + . insertions 0 ; deletions 0 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice5 22809 22810 . + . intron_id 5 ; splice_site "GT" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local intron 22809 25425 . + . intron_id 5 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice3 25424 25425 . + . intron_id 4 ; splice_site "ag" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local cds 25426 25485 . + . KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local exon 25426 25485 . + . insertions 0 ; deletions 0 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice5 25486 25487 . + . intron_id 6 ; splice_site "GT" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local intron 25486 27309 . + . intron_id 6 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local splice3 27308 27309 . + . intron_id 5 ; splice_site "AG" KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local cds 27310 27336 . + . KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local exon 27310 27336 . + . insertions 0 ; deletions 0 KQ747986.1:subseq(139499,45488) exonerate:protein2genome:local similarity 11223 27336 734 + . alignment_id 1 ; Query SPP00000026_2.0 ; Align 11223 9 60 ; Align 20000 29 93 ; Align 21236 61 144 ; Align 21475 109 150 ; Align 22785 160 24 ; Align 25426 168 60 ; Align 27310 188 27 # --- END OF GFF DUMP --- # -- completed exonerate analysis