Command line: [exonerate -m p2g --showtargetgff -q SelW3/SelW3_x.fa -t SelW3/SUBSEQ/CM004441.1_1_subseq.txt --exhaustive] Hostname: [ws101122u] C4 Alignment: ------------ Query: SPP00000659_2.0 Protein Selenoprotein W (SELENOW) Zebrafish Target: CM004441.1:subseq(4571575,25095) Ictalurus punctatus breed USDA103 chromosome 28, whole genome shotgun sequence Model: protein2genome:local Raw score: 343 Query range: 0 -> 86 Target range: 21253 -> 25095 1 : MetThrValLysValHisValValTyr{Cy} >>>> Target Intron 1 >>>> : 10 |||.!!||||||:!!|||:!!:!!|||{||} 1231 bp MetAlaValLysIleHisIleIleTyr{Cy}++ ++ 21254 : ATGGCCGTCAAAATACATATAATTTAC{TG}gt.........................ag : 22512 11 : {s}GlyGlyUnkGlyTyrArgProLys >>>> Target Intron 2 >>>> PheI : 20 {|}|||||| ||||||||||||||| 124 bp !| {s}GlyGly***GlyTyrArgProLys++ ++AlaI 22513 : {T}GGTGGATGAGGGTACAGGCCCAAggt.........................agGCCA : 22666 21 : leLysLeuLysThrLeuLeuGluAspGluPheProAsnGluLeuGluIle >>>> Tar : 37 ||||||||! !||||||||||||||||||||||||..!!!::!!|||||| leLysLeuThrThrLeuLeuGluAspGluPheProGlyAspValGluIle++ 22667 : TCAAGCTCACAACGTTGCTTGAGGATGAATTTCCAGGCGACGTTGAGATCgt........ : 22719 38 : get Intron 3 >>>> ThrGlyGluGlyThrProSerThrThrGlyTrpLeuGluVa : 50 1540 bp |||.!!||||||||||||!!!||||||||||||!!!||||| ++ThrSerGluGlyThrProThrThrThrGlyTrpPheGluVa 22720 : .................agACAAGTGAGGGCACTCCCACAACAACTGGGTGGTTTGAGGT : 24296 51 : lGluValAsnGlyLysLeuValHisSerLysLys >>>> Target Intron 4 >>> : 62 |:!!|||||||||! !|||||||||||||||||| 689 bp lGlnValAsnGlyThrLeuValHisSerLysLys++ 24297 : GCAGGTGAATGGCACACTGGTGCACTCGAAGAAGgt........................ : 24334 63 : > AsnGlyAspGlyPheValAspSerAspSerLysMetGlnLysIleValThrAlaIle : 80 |||||||||||||||||||||!:!|||..!|||:!: |||||||||!:!|||||| ++AsnGlyAspGlyPheValAspAsnAspGlnLysLeuAlaLysIleValSerAlaIle 24335 : .agAATGGGGACGGCTTCGTGGACAACGATCAGAAGCTTGCCAAGATTGTGAGTGCCATT : 25075 81 : GluGlnAlaMetGlyLys : 86 |||:!!|||!!:|||||| GluLysAlaIleGlyLys 25076 : GAGAAAGCCATAGGCAAA : 25095 vulgar: SPP00000659_2.0 0 86 . CM004441.1:subseq(4571575,25095) 21253 25095 + 343 M 9 27 S 0 2 5 0 2 I 0 1227 3 0 2 S 1 1 M 8 24 5 0 2 I 0 120 3 0 2 M 18 54 5 0 2 I 0 1536 3 0 2 M 25 75 5 0 2 I 0 685 3 0 2 M 25 75 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-15 ##type DNA # # # seqname source feature start end score strand frame attributes # CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local gene 21254 25095 343 + . gene_id 1 ; sequence SPP00000659_2.0 ; gene_orientation + CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local cds 21254 21282 . + . CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local exon 21254 21282 . + . insertions 0 ; deletions 0 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice5 21283 21284 . + . intron_id 1 ; splice_site "GT" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local intron 21283 22513 . + . intron_id 1 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice3 22512 22513 . + . intron_id 0 ; splice_site "AG" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local cds 22514 22538 . + . CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local exon 22514 22538 . + . insertions 0 ; deletions 0 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice5 22539 22540 . + . intron_id 2 ; splice_site "gt" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local intron 22539 22662 . + . intron_id 2 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice3 22661 22662 . + . intron_id 1 ; splice_site "AG" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local cds 22663 22716 . + . CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local exon 22663 22716 . + . insertions 0 ; deletions 0 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice5 22717 22718 . + . intron_id 3 ; splice_site "GT" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local intron 22717 24256 . + . intron_id 3 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice3 24255 24256 . + . intron_id 2 ; splice_site "AG" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local cds 24257 24331 . + . CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local exon 24257 24331 . + . insertions 0 ; deletions 0 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice5 24332 24333 . + . intron_id 4 ; splice_site "GT" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local intron 24332 25020 . + . intron_id 4 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local splice3 25019 25020 . + . intron_id 3 ; splice_site "AG" CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local cds 25021 25095 . + . CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local exon 25021 25095 . + . insertions 0 ; deletions 0 CM004441.1:subseq(4571575,25095) exonerate:protein2genome:local similarity 21254 25095 343 + . alignment_id 1 ; Query SPP00000659_2.0 ; Align 21254 1 27 ; Align 22515 11 24 ; Align 22663 19 54 ; Align 24257 37 75 ; Align 25021 62 75 # --- END OF GFF DUMP --- # -- completed exonerate analysis