Command line: [exonerate -m p2g --showtargetgff -q SELENOI.fa -t genomic.fa] Hostname: [ws101074u] C4 Alignment: ------------ Query: SPP00000074_2.0 # Protein # Selenoprotein I (SELENOI) # Human Target: CM004428.1:subseq(5100000,1500000) Ictalurus p ctatus breed USDA103 chromosome 15, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 1470 Query range: 0 -> 386 Target range: 15316 -> 4708 1 : MetAlaGlyTyrGluTyrValSerProGluGlnLeuAlaGlyPheAspLysTyrLys > : 20 |||||| !||||||||||||!!!! !|||||||||:!!|||||||||||||||||| MetAlaLeuTyrGluTyrValThrGlnGluGlnLeuSerGlyPheAspLysTyrLys++ 15316 : ATGGCTCTGTACGAATATGTCACTCAGGAGCAGCTCTCCGGTTTTGATAAATATAAGgt. : 15257 21 : >>> Target Intron 1 >>>> TyrSerAlaValAspThrAsnProLeuSerLeuT : 31 3203 bp ||||||||||||||||||||||||||||||:!!| ++TyrSerAlaValAspThrAsnProLeuSerIleT 15256 : ........................agtacagtgcagtggacaCCAACCCGCTCTCCATCT : 12023 32 : yrValMetHisProPheTrpAsnThrIleValLys >>>> Target Intron 2 >> : 43 ||:!!||||||||||||||||||:!!!!:|||||| 959 bp yrIleMetHisProPheTrpAsnSerMetValLys++ 12022 : ACATCATGCACCCCTTCTGGAACTCCATGGTGAAGgt....................... : 11985 44 : >> ValPheProThrTrpLeuAlaProAsnLeuIleThrPheSerGlyPheLeuLeuVa : 61 :::...|||||||||||||||||||||||||||||||||!!!||||||:!!!!!:! ++IleLeuProThrTrpLeuAlaProAsnLeuIleThrPheThrGlyPheMetPheLe 11984 : ..agatcttGCCCACATGGCTGGCCCCTAACCTCATCACCTTCACTGGGTTCATGTTCCT : 10974 62 : lValPheAsnPheLeuLeuMetAlaTyrPheAspProAspPheTyrAlaSer{A} >>> : 79 !|||.!!|||||| !:!!:!::!!!:!!:!||| !|||||||||||||||{|} uValLeuAsnPheAlaIleLeuSerPheTyrAspPheAspPheTyrAlaSer{A}++ 10973 : GGTGCTCAACTTTGCCATCTTATCCTTCTACGACTTTGACTTCTACGCATCa{g}gt... : 10917 80 : > Target Intron 3 >>>> {la}ProGlyHisLysHisValProAspTrpValTr : 90 520 bp {||} !|||||| !||||||||| !|||||||| ++{la}GluGlyHisAlaHisValProThrTrpValTr 10916 : ......................ag{cg}gAGGGTCATGCACACGTGCCAACTTGGGTTTG : 10367 91 : pIleValValGlyIleLeuAsnPheValAlaTyrThrLeu{A} >>>> Target Int : 104 ||||!.!!.!|||:!!!!!||||||:!!||||||||||||{|} 381 b pIleAlaAlaGlyLeuPheAsnPheLeuAlaTyrThrLeu{A}++ 10366 : GATAGCCGCGGGCCTCTTCAACTTTCTGGCATACACActa{g}gt............... : 10322 105 : ron 4 >>>> {sp}GlyValAspGlyLysGlnAlaArgArgThrAsnSerSerThrPr : 119 p {||}|||||||||||||||||||||||||||||||||||||||||||| ++{sp}GlyValAspGlyLysGlnAlaArgArgThrAsnSerSerThrPr 10321 : ..........ag{ac}ggtGTGGATGGGAAGCAGGCTCGCAGGACGAACTCGAGCACTCC : 9899 120 : oLeuGlyGluLeuPheAspHisGlyLeuAspSerTrpSerCysValTyrPheValValTh : 139 |||||||||||||||||||||||||||||||||||||:!!||||||!:!|||||| !:! oLeuGlyGluLeuPheAspHisGlyLeuAspSerTrpAlaCysValPhePheValSerSe 9898 : TCTGGGTGAGCTGTTTGACCATGGCCTGGACAGCTGGGCGTGTGTGTTCTTCGTGAGCTC : 9839 140 : rValTyrSerIlePheGlyArgGlySerThrGlyValSerValPheValLeuTyrLeuLe : 159 !:!!||||||:!:||||||||||||..!!:!||||||!!!|||.!!..!|||||| !|| rLeuTyrSerValPheGlyArgGlyGluSerGlyValThrValLeuThrLeuTyrGlyLe 9838 : CCTGTACTCTGTGTTCGGGCGTGGCGAGAGCGGGGTCACCGTGCTCACACTCTACGGCCT : 9779 160 : uLeuTrpValValLeuPheSerPheIleLeuSerHisTrpGluLysTyrAsnThrGlyIl : 179 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||:! uLeuTrpValValLeuPheSerPheIleLeuSerHisTrpGluLysTyrAsnThrGlyVa 9778 : GCTCTGGGTCGTCCTCTTCTCTTTCATCCTCTCACACTGGGAGAAATATAACACTGGCGT : 9719 180 : eLeuPheLeuProTrpGlyTyrAspIleSerGlnVal >>>> Target Intron 5 : 192 :|||||||||||||||||||||||||||||||||||| 2403 bp lLeuPheLeuProTrpGlyTyrAspIleSerGlnVal++ 9718 : GCTCTTCCTGCCCTGGGGCTACGACATCAGCCAAGTGgt..................... : 9678 193 : >>>> ThrIleSerPheValTyrIleValThrAlaValValGlyValGluAlaTrpTyr : 209 |||||||||.!!|||||||||||||||||||||||||||||||||.!!|||||| ++ThrIleSerIleValTyrIleValThrAlaValValGlyValGluThrTrpTyr 9677 : ....agACAATCTCTATCGTTTACATCGTCACGGCTGTGGTCGGAGTGGAGACATGGTAC : 7226 210 : GluProPheLeuPheAsnPheLeuTyrArgAspLeuPheThrAlaMetIleIle{G} > : 228 :!!|||.!.:!!!::|||.!!||||||||||||||||||! !!.!||||||:!:{|} LysProLeuIleTrpAsnIleLeuTyrArgAspLeuPheIleValMetIleLeu{G}++ 7225 : AAACCACTGATCTGGAACATTCTCTACAGAGACCTCTTCATCGTCATGATCCTG{G}gt. : 7166 229 : >>> Target Intron 6 >>>> {ly}CysAlaLeuCysValThrLeuProMetSer : 238 124 bp {||}||| ......|||||||||||||||||| ++{ly}CysLeuPheAlaValThrLeuProMetSer 7165 : ........................ag{gt}tgtttgtttgctgtaaCGTTACCAATGAGC : 7015 239 : LeuLeuAsnPhePhe{Ar} >>>> Target Intron 7 >>>> {g}SerTyrLys : 247 |||! !||| !!|||{!:} 409 bp {!}:!!|||::: LeuTyrAsnValPhe{Ly}++ ++{s}AlaTyrArg 7014 : CTTTACAACGTCTTT{AA}gt.........................ag{G}GCGTATCGC : 6579 248 : AsnAsnThrLeuLysLeuAsnSerValTyrGluAlaMetValProLeuPheSerProCys : 267 !:!||||||||||||! !!:!|||||||||||||||:!::!!|||!!!||||||||| SerAsnThrLeuLysHisSerSerValTyrGluAlaLeuLeuProPhePheSerProIle 6578 : AGCAACACACTGAAGCACAGCTCTGTGTACGAGGCCCTCCTGCCCTTCTTCTCGCCCatt : 6519 268 : LeuLeuPheIleLeuSerThrAlaTrpIleLeuTrpSerProSerAspIleLeuGluLeu : 287 |||||||||||||||:!!||| !|||:!!:!! !|||||||||:!!|||||||||||| LeuLeuPheIleLeuAlaThrLeuTrpValIleLeuSerProSerAsnIleLeuGluLeu 6518 : ctcctcttcatcctcGCCACTCTGTGGGTCATCCTGTCCCCGAGCAACATCCTAGAGCTG : 6459 288 : HisProArgValPheTyrPheMetValGlyThrAlaPheAlaAsnSerThr >>>> Ta : 305 !!.||||||:!!||||||.!.|||||||||||||||||||||||| !||| GlnProArgIlePheTyrLeuMetValGlyThrAlaPheAlaAsnValThr++ 6458 : CAGCCCAGAATCTTCTACCTGATGGTGGGAACAGCCTTCGCCAACGTTACTgt....... : 6403 306 : rget Intron 8 >>>> CysGlnLeuIleValCysGlnMetSerSerThrArgCysP : 318 456 bp |||:!!|||||||||||||||||||||!:!|||||||||! ++CysLysLeuIleValCysGlnMetSerAsnThrArgCysG 6402 : ..................agTGTAAGCTGATCGTGTGTCAGATGAGTAACACACGCTGCC : 5910 319 : roThrLeuAsnTrpLeuLeuValProLeuPheLeuValValLeuValValAsnLeuGlyV : 338 ! !!|||!:!|||||||||||||||::: ||||||||||||:!!|||! !! !|||: lnProLeuSerTrpLeuLeuValProMetValLeuValValLeuLeuValIleCysGlyM 5909 : AGCCTTTGAGTTGGCTGTTGGTGCCgatggtgttggtggtgttgcTGGTGATCTGCGGCA : 5850 339 : alAlaSerTyrValGluSerIleLeuLeuTyrThrLeuThrThrAlaPheThrLeuAlaH : 358 !!!.!..! !! !|||!!!:!:|||||||||..!! !|||.!!!.! !!! !||||||| etValGlnAspSerGluThrValLeuLeuTyrValCysThrAlaValValIleLeuAlaH 5849 : TGGTGCAGGATAGTGAGACGGTGCTGTTGTACGTGTGCACGGCTGTGGTCATCCTCGCAC : 5790 359 : isIleHisTyrGlyValArgVal >>>> Target Intron 9 >>>> ValLysGl : 368 ||||||||||||||||| !||| 993 bp |||!:!|| isIleHisTyrGlyValSerVal++ ++ValArgGl 5789 : ACATACACTATGGGGTTTCAGTGgt.........................aggTGAGACA : 4767 369 : nLeuSerSerHisPheGlnIleTyrProPheSerLeuArgLysProAsnSerAspUnk : 387 |||||||.!!||||||:!!|||||| !!|||||||||!:!|||||| !! !||| nLeuSerGlyHisPheLysIleTyrAlaPheSerLeuLysLysProCysLeuAsp*** 4766 : GTTGAGCGGTCACTTTAAGATCTATGCGTTCTCGCTGAAGAAGCCCTGCTTGGACTGA : 4708 vulgar: SPP00000074_2.0 0 386 . CM004428.1:subseq(5100000,1500000) 15316 4710 - 1470 M 19 57 5 0 2 I 0 3199 3 0 2 M 23 69 5 0 2 I 0 955 3 0 2 M 36 108 S 0 1 5 0 2 I 0 516 3 0 2 S 1 2 M 24 72 S 0 1 5 0 2 I 0 377 3 0 2 S 1 2 M 87 261 5 0 2 I 0 2399 3 0 2 M 36 108 S 0 1 5 0 2 I 0 120 3 0 2 S 1 2 M 15 45 S 0 2 5 0 2 I 0 405 3 0 2 S 1 1 M 60 180 5 0 2 I 0 452 3 0 2 M 61 183 5 0 2 I 0 989 3 0 2 M 21 63 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-23 ##type DNA # # # seqname source feature start end score strand frame attributes # CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local gene 4708 15316 1470 - . gene_id 1 ; sequence SPP00000074_2.0 ; gene_orientation + CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 15260 15316 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 15260 15316 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 15258 15259 . - . intron_id 1 ; splice_site "GT" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 12057 15259 . - . intron_id 1 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 12057 12058 . - . intron_id 0 ; splice_site "ag" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 11988 12056 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 11988 12056 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 11986 11987 . - . intron_id 2 ; splice_site "GT" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 11029 11987 . - . intron_id 2 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 11029 11030 . - . intron_id 1 ; splice_site "ag" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 10920 11028 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 10920 11028 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 10918 10919 . - . intron_id 3 ; splice_site "gt" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 10400 10919 . - . intron_id 3 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 10400 10401 . - . intron_id 2 ; splice_site "ag" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 10325 10399 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 10325 10399 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 10323 10324 . - . intron_id 4 ; splice_site "gt" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 9944 10324 . - . intron_id 4 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 9944 9945 . - . intron_id 3 ; splice_site "ag" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 9681 9943 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 9681 9943 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 9679 9680 . - . intron_id 5 ; splice_site "GT" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 7278 9680 . - . intron_id 5 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 7278 7279 . - . intron_id 4 ; splice_site "AG" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 7169 7277 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 7169 7277 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 7167 7168 . - . intron_id 6 ; splice_site "GT" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 7045 7168 . - . intron_id 6 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 7045 7046 . - . intron_id 5 ; splice_site "ag" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 6996 7044 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 6996 7044 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 6994 6995 . - . intron_id 7 ; splice_site "GT" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 6587 6995 . - . intron_id 7 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 6587 6588 . - . intron_id 6 ; splice_site "AG" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 6406 6586 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 6406 6586 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 6404 6405 . - . intron_id 8 ; splice_site "GT" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 5950 6405 . - . intron_id 8 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 5950 5951 . - . intron_id 7 ; splice_site "AG" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 5767 5949 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 5767 5949 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice5 5765 5766 . - . intron_id 9 ; splice_site "GT" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local intron 4774 5766 . - . intron_id 9 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local splice3 4774 4775 . - . intron_id 8 ; splice_site "ag" CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local cds 4714 4773 . - . CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local exon 4708 4773 . - . insertions 0 ; deletions 0 CM004428.1:subseq(5100000,1500000) exonerate:protein2genome:local similarity 4708 15316 1470 - . alignment_id 1 ; Query SPP00000074_2.0 ; Align 15317 1 57 ; Align 12057 20 69 ; Align 11029 43 108 ; Align 10398 80 72 ; Align 9942 105 261 ; Align 7278 192 108 ; Align 7043 229 45 ; Align 6586 245 180 ; Align 5950 305 183 ; Align 4774 366 63 # --- END OF GFF DUMP --- # -- completed exonerate analysis