Command line: [exonerate -m p2g --showtargetgff -q SELENOW2.aa.fa -t SELENOW2_JSZB01001359.1.subseq.fa] Hostname: [ws101066u] C4 Alignment: ------------ Query: SPP00000127_2.0 # Protein # Selenoprotein W2 (SELENOW2) # Human Target: JSZB01001359.1:subseq(200000,100000) Manis javanica isolate MP_PG03-UM SCAFFOLD1497, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 535 Query range: 0 -> 115 Target range: 57521 -> 56552 1 : MetSerGlyGluProGlyGlnThrSerValAlaProProProGluGluValGluProGly : 20 ||||||||||||! !|||! !.!!||||||||||||||||||! !|||:!!||||||||| MetSerGlyGluGlnGlyProAlaSerValAlaProProProGlyGluIleGluProGly 57521 : ATGAGCGGGGAGCAGGGGCCGGCGTCTGTAGCGCCCCCTCCCGGGGAGATCGAACCGGGC : 57464 21 : SerGlyValArgIleValValGluTyr{Cy} >>>> Target Intron 1 >>>> : 30 !!||||||||||||||||||||||||{||} 104 bp ArgGlyValArgIleValValGluTyr{Cy}++ ++ 57463 : CGTGGGGTCCGCATTGTGGTGGAGTAC{TG}gt.........................ag : 57330 31 : {s}GluProCysGlyPheGluAlaThrTyrLeuGluLeuAlaSerAlaValLysGluGln : 49 {|}||||||||||||||||||||||||||||||||||||||||||||||||||||||||| {s}GluProCysGlyPheGluAlaThrTyrLeuGluLeuAlaSerAlaValLysGluGln 57329 : {T}GAACCTTGCGGCTTCGAGGCGACCTACCTGGAGCTGGCGAGTGCCGTGAAGGAGCAG : 57273 50 : TyrProGlyIleGluIleGluSerArgLeuGlyGlyThr{G} >>>> Target Intr : 63 |||||||||||||||||||||||||||||||||||||||{|} 437 bp TyrProGlyIleGluIleGluSerArgLeuGlyGlyThr{G}++ 57272 : TATCCTGGCATTGAGATCGAGTCACGTCTCGGGGGCACA{G}gt................ : 57228 64 : on 2 >>>> {ly}AlaPheGluIleGluIleAsnGlyGlnLeuValPheSerLysLeu : 78 {||}||||||||||||||||||||||||||||||||||||||||||||| ++{ly}AlaPheGluIleGluIleAsnGlyGlnLeuValPheSerLysLeu 57227 : .........ag{gg}GCTTTTGAGATTGAGATCAATGGACAGCTGGTGTTCTCCAAGCTG : 56749 79 : GluAsnGlyGlyPheProTyrGluLysAsp >>>> Target Intron 3 >>>> L : 89 |||||||||||||||||||||||||||||| 83 bp | GluAsnGlyGlyPheProTyrGluLysAsp++ ++L 56748 : GAGAATGGGGGCTTTCCTTATGAGAAAGATgt.........................agC : 56633 90 : euIleGluAlaIleArgArgAlaSerAsnGlyGluThrLeuGluLysIleThrAsnSerA : 109 ||||||||||||||||||||||||||||||||||| !!|||||||||||||||||||||| euIleGluAlaIleArgArgAlaSerAsnGlyGluProLeuGluLysIleThrAsnSerA 56632 : TCATTGAGGCCATCCGAAGAGCCAGTAACGGAGAACCCCTAGAAAAGATCACCAACAGCC : 56573 110 : rgProProCysValIleLeu : 115 |||||||||||||||||||| rgProProCysValIleLeu 56572 : GGCCTCCCTGTGTCATCCTG : 56553 vulgar: SPP00000127_2.0 0 115 . JSZB01001359.1:subseq(200000,100000) 57521 56552 - 535 M 29 87 S 0 2 5 0 2 I 0 100 3 0 2 S 1 1 M 32 96 S 0 1 5 0 2 I 0 433 3 0 2 S 1 2 M 25 75 5 0 2 I 0 79 3 0 2 M 27 81 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-11 ##type DNA # # # seqname source feature start end score strand frame attributes # JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local gene 56553 57521 535 - . gene_id 1 ; sequence SPP00000127_2.0 ; gene_orientation + JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local cds 57433 57521 . - . JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local exon 57433 57521 . - . insertions 0 ; deletions 0 JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local splice5 57431 57432 . - . intron_id 1 ; splice_site "GT" JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local intron 57329 57432 . - . intron_id 1 JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local splice3 57329 57330 . - . intron_id 0 ; splice_site "AG" JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local cds 57231 57328 . - . JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local exon 57231 57328 . - . insertions 0 ; deletions 0 JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local splice5 57229 57230 . - . intron_id 2 ; splice_site "GT" JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local intron 56794 57230 . - . intron_id 2 JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local splice3 56794 56795 . - . intron_id 1 ; splice_site "ag" JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local cds 56717 56793 . - . JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local exon 56717 56793 . - . insertions 0 ; deletions 0 JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local splice5 56715 56716 . - . intron_id 3 ; splice_site "GT" JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local intron 56634 56716 . - . intron_id 3 JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local splice3 56634 56635 . - . intron_id 2 ; splice_site "AG" JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local cds 56553 56633 . - . JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local exon 56553 56633 . - . insertions 0 ; deletions 0 JSZB01001359.1:subseq(200000,100000) exonerate:protein2genome:local similarity 56553 57521 535 - . alignment_id 1 ; Query SPP00000127_2.0 ; Align 57522 1 87 ; Align 57328 31 96 ; Align 56792 64 75 ; Align 56634 89 81 # --- END OF GFF DUMP --- # -- completed exonerate analysis