Command line: [exonerate -m p2g --showtargetgff -q GPx4.fa -t GPx4.subseq.fa] Hostname: [ws116037u] C4 Alignment: ------------ Query: SPP00000026_2.0 # Protein # Glutathione peroxidase 4 (GPx4) # Human Target: JSZB01061009.1:subseq(4000,100000) Manis javanica isolate MP_PG03-UM SCAFFOLD96784, whole genome shotgun sequence Model: protein2genome:local Raw score: 962 Query range: 0 -> 197 Target range: 50869 -> 52708 1 : MetSerLeuGlyArgLeuCysArgLeuLeuLysProAlaLeuLeuCysGlyAlaLeuAla : 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MetSerLeuGlyArgLeuCysArgLeuLeuLysProAlaLeuLeuCysGlyAlaLeuAla 50870 : ATGAGTCTCGGCCGTCTGTGCCGCCTGCTGAAGCCGGCGCTGTTGTGCGGGGCACTGGCG : 50927 21 : AlaProGlyLeuAlaGlyThrMet >>>> Target Intron 1 >>>> CysAlaS : 31 |||||||||||||||||||||||| 741 bp ||||||: AlaProGlyLeuAlaGlyThrMet++ ++CysAlaA 50928 : GCGCCCGGCCTGGCGGGCACCATGgt.........................agTGCGCGG : 51701 32 : erArgAspAspTrpArgCysAlaArgSerMetHisGluPheSerAlaLysAspIleAspG : 51 !!|||||||||||||||! !|||!.!|||||||||||||||||||||||||||||||||| laArgAspAspTrpArgSerAlaHisSerMetHisGluPheSerAlaLysAspIleAspG 51702 : CCCGCGACGACTGGCGCTCTGCTCACTCCATGCACGAGTTCTCAGCCAAGGACATCGATG : 51761 52 : lyHisMetValAsnLeuAspLysTyr{Ar} >>>> Target Intron 2 >>>> { : 60 ||||||||||||||||||||||||||{||} 80 bp { lyHisMetValAsnLeuAspLysTyr{Ar}++ ++{ 51762 : GGCACATGGTTAACCTGGACAAGTAC{CG}gt.........................ag{ : 51870 61 : g}GlyPheValCysIleValThrAsnValAlaSerGlnUnkGlyLysThrGluValAsnT : 80 |}|||||||||||||||||||||||||||||||||||| |||||||||!!:||||||| g}GlyPheValCysIleValThrAsnValAlaSerGln***GlyLysThrAspValAsnT 51871 : G}GGCTTCGTGTGCATCGTCACCAACGTGGCCTCGCAATGAGGCAAAACAGACGTAAACT : 51928 81 : yrThrGlnLeuValAspLeuHisAlaArgTyrAlaGluCysGlyLeuArgIleLeuAlaP : 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| yrThrGlnLeuValAspLeuHisAlaArgTyrAlaGluCysGlyLeuArgIleLeuAlaP 51929 : ACACTCAGCTTGTCGACCTGCACGCCCGATACGCTGAGTGCGGTTTGCGGATCCTGGCCT : 51988 101 : heProCysAsnGlnPheGlyLysGln >>>> Target Intron 3 >>>> GluPr : 110 |||||||||||||||||||||||||| 122 bp ||||| heProCysAsnGlnPheGlyLysGln++ ++GluPr 51989 : TCCCCTGCAACCAGTTTGGGAAACAGgt.........................agGAGCC : 52140 111 : oGlySerAsnGluGluIleLysGluPheAlaAlaGlyTyrAsnValLysPheAspMetPh : 130 ||||||||||! !|||||||||||||||||||||||||||||||||||||||||||||!: oGlySerAsnAlaGluIleLysGluPheAlaAlaGlyTyrAsnValLysPheAspMetTy 52141 : AGGGAGCAACGCGGAGATCAAAGAGTTTGCCGCTGGCTATAACGTCAAGTTTGATATGTA : 52200 131 : eSerLysIleCysValAsnGlyAspAspAlaHisProLeuTrpLysTrpMetLysIleGl : 150 !|||||||||||||||||||||||||||||||||||||||||||||||||||||| !|| rSerLysIleCysValAsnGlyAspAspAlaHisProLeuTrpLysTrpMetLysAlaGl 52201 : CAGCAAGATCTGTGTGAACGGAGATGATGCCCACCCGCTGTGGAAGTGGATGAAAGCCCA : 52260 151 : nProLysGlyLysGlyIleLeuGly{As} >>>> Target Intron 4 >>>> {n : 159 ||||||||||!:!|||! !||||||{||} 103 bp {| nProLysGlyArgGlyThrLeuGly{As}++ ++{n 52261 : GCCCAAGGGGAGGGGCACCCTGGGG{AA}gt.........................ag{T : 52392 160 : }AlaIleLysTrpAsnPheThrLys >>>> Target Intron 5 >>>> PheLeu : 169 }|||||||||||||||||||||||| 124 bp |||||| }AlaIleLysTrpAsnPheThrLys++ ++PheLeu 52393 : }GCCATCAAATGGAACTTCACCAAGgt.........................agTTCCTC : 52544 170 : IleAspLysAsnGlyCysValValLysArgTyrGlyProMetGluGluProLeu >>>> : 188 |||||||||||||||||||||||||||||||||||||||||||||||||||||| IleAspLysAsnGlyCysValValLysArgTyrGlyProMetGluGluProLeu++ 52545 : ATCGACAAGAACGGCTGTGTGGTGAAGCGGTATGGGCCCATGGAAGAGCCTCTGgt.... : 52603 189 : Target Intron 6 >>>> ValIleGluLysAspLeuProHisTyrPhe : 197 78 bp ||||||||||||||||||||| !:!!||| ++ValIleGluLysAspLeuProCysHisPhe 52604 : .....................agGTGATAGAGAAGGACCTGCCCTGCCACTTC : 52708 vulgar: SPP00000026_2.0 0 197 . JSZB01061009.1:subseq(4000,100000) 50869 52708 + 962 M 28 84 5 0 2 I 0 737 3 0 2 M 31 93 S 0 2 5 0 2 I 0 76 3 0 2 S 1 1 M 48 144 5 0 2 I 0 118 3 0 2 M 50 150 S 0 2 5 0 2 I 0 99 3 0 2 S 1 1 M 8 24 5 0 2 I 0 120 3 0 2 M 20 60 5 0 2 I 0 74 3 0 2 M 10 30 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-22 ##type DNA # # # seqname source feature start end score strand frame attributes # JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local gene 50870 52708 962 + . gene_id 1 ; sequence SPP00000026_2.0 ; gene_orientation + JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local cds 50870 50953 . + . JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local exon 50870 50953 . + . insertions 0 ; deletions 0 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice5 50954 50955 . + . intron_id 1 ; splice_site "GT" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local intron 50954 51694 . + . intron_id 1 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice3 51693 51694 . + . intron_id 0 ; splice_site "AG" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local cds 51695 51789 . + . JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local exon 51695 51789 . + . insertions 0 ; deletions 0 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice5 51790 51791 . + . intron_id 2 ; splice_site "GT" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local intron 51790 51869 . + . intron_id 2 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice3 51868 51869 . + . intron_id 1 ; splice_site "AG" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local cds 51870 52014 . + . JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local exon 51870 52014 . + . insertions 0 ; deletions 0 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice5 52015 52016 . + . intron_id 3 ; splice_site "GT" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local intron 52015 52136 . + . intron_id 3 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice3 52135 52136 . + . intron_id 2 ; splice_site "AG" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local cds 52137 52288 . + . JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local exon 52137 52288 . + . insertions 0 ; deletions 0 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice5 52289 52290 . + . intron_id 4 ; splice_site "GT" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local intron 52289 52391 . + . intron_id 4 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice3 52390 52391 . + . intron_id 3 ; splice_site "AG" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local cds 52392 52416 . + . JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local exon 52392 52416 . + . insertions 0 ; deletions 0 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice5 52417 52418 . + . intron_id 5 ; splice_site "GT" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local intron 52417 52540 . + . intron_id 5 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice3 52539 52540 . + . intron_id 4 ; splice_site "AG" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local cds 52541 52600 . + . JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local exon 52541 52600 . + . insertions 0 ; deletions 0 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice5 52601 52602 . + . intron_id 6 ; splice_site "GT" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local intron 52601 52678 . + . intron_id 6 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local splice3 52677 52678 . + . intron_id 5 ; splice_site "AG" JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local cds 52679 52708 . + . JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local exon 52679 52708 . + . insertions 0 ; deletions 0 JSZB01061009.1:subseq(4000,100000) exonerate:protein2genome:local similarity 50870 52708 962 + . alignment_id 1 ; Query SPP00000026_2.0 ; Align 50870 1 84 ; Align 51695 29 93 ; Align 51871 61 144 ; Align 52137 109 150 ; Align 52393 160 24 ; Align 52541 168 60 ; Align 52679 188 30 # --- END OF GFF DUMP --- # -- completed exonerate analysis