Command line: [exonerate -m p2g --showtargetgff -q EIF4A3.fa -t EIF4A3.subseq] Hostname: [ws101098U] C4 Alignment: ------------ Query: SPP00002927_2.0 # Protein # eukaryotic translation initiation factor 4A3 (EIF4A3) # Human Target: JSZB01021220.1:subseq(63000,63392) Manis javanica isolate MP_PG03-UM SCAFFOLD26531, whole genome shotgun sequence Model: protein2genome:local Raw score: 1985 Query range: 0 -> 406 Target range: 50596 -> 60076 1 : MetAlaThrThrAlaThrMetAlaThrSerGlySerAlaArgLysArgLeuLeuLysGlu : 20 ||||||.!!.!!|||||||||||||||||||||||||||||||||||||||||||||||| MetAlaAlaAlaAlaThrMetAlaThrSerGlySerAlaArgLysArgLeuLeuLysGlu 50597 : ATGGCGGCCGCCGCCACGATGGCGACCTCGGGCTCGGCGCGGAAGCGGCTGCTCAAAGAG : 50654 21 : GluAspMetThrLysValGluPheGluThrSerGluGluValAspValThrProThrPhe : 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GluAspMetThrLysValGluPheGluThrSerGluGluValAspValThrProThrPhe 50655 : GAAGACATGACCAAAGTGGAATTCGAGACCAGCGAGGAGGTGGACGTGACCCCCACTTTC : 50714 41 : AspThrMetGlyLeuArgGluAspLeuLeuArgGlyIleTyrAlaTyr{G} >>>> Ta : 57 ||||||||||||||||||||||||||||||||||||||||||||||||{|} AspThrMetGlyLeuArgGluAspLeuLeuArgGlyIleTyrAlaTyr{G}++ 50715 : GACACCATGGGCCTGCGGGAGGACCTGCTGCGCGGCATCTACGCCTAC{G}gt....... : 50768 58 : rget Intron 1 >>>> {ly}PheGluLysProSerAlaIleGlnGlnArgAlaIle : 69 1952 bp {||}|||||||||||||||||||||||||||||||||||| ++{ly}PheGluLysProSerAlaIleGlnGlnArgAlaIle 50769 : ..................ag{GT}TTTGAAAAACCATCTGCCATCCAACAGCGAGCTATC : 52753 70 : LysGlnIleIleLysGlyArgAspValIleAla{Gl} >>>> Target Intron 2 : 81 |||||||||||||||||||||||||||||||||{||} 690 bp LysGlnIleIleLysGlyArgAspValIleAla{Gl}++ 52754 : AAGCAAATAATTAAAGGGAGAGACGTCATTGCT{CA}gt..................... : 52793 82 : >>>> {n}SerGlnSerGlyThrGlyLysThrAlaThrPheSerIleSerValLeuGln : 98 {|}||||||||||||||||||||||||||||||||||||||||||||||||||| ++{n}SerGlnSerGlyThrGlyLysThrAlaThrPheSerIleSerValLeuGln 52794 : ....ag{A}TCTCAGTCTGGTACAGGCAAAACAGCCACCTTCAGTATCTCTGTCCTCCAG : 53530 99 : CysLeuAspIleGln >>>> Target Intron 3 >>>> ValArgGluThrGlnA : 109 ||||||||||||||| 405 bp |||||||||||||||| CysLeuAspIleGln++ ++ValArgGluThrGlnA 53531 : TGTTTGGATATTCAGgt.........................agGTTCGTGAAACCCAAG : 53968 110 : laLeuIleLeuAlaProThrArgGluLeuAlaValGlnIleGlnLys >>>> Target : 125 ||||||||||||||||||||||||||||||||||||||||||||||| 6 laLeuIleLeuAlaProThrArgGluLeuAlaValGlnIleGlnLys++ 53969 : CTTTGATCTTGGCTCCAACGAGAGAACTGGCCGTGCAGATCCAGAAGgt........... : 54018 126 : Intron 4 >>>> GlyLeuLeuAlaLeuGlyAspTyrMetAsnValGlnCysHisAl : 139 18 bp |||||||||||||||||||||||||||||||||||||||||||| ++GlyLeuLeuAlaLeuGlyAspTyrMetAsnValGlnCysHisAl 54019 : ..............agGGCCTGCTTGCTCTGGGTGACTACATGAACGTCCAGTGCCATGC : 54676 140 : aCysIleGlyGlyThrAsnValGlyGluAspIleArgLysLeuAspTyrGlyGlnHisVa : 159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| aCysIleGlyGlyThrAsnValGlyGluAspIleArgLysLeuAspTyrGlyGlnHisVa 54677 : GTGCATCGGGGGCACCAACGTGGGGGAGGACATCAGGAAGCTGGACTACGGGCAGCACGT : 54736 160 : lValAlaGlyThrProGlyArgValPhe{A} >>>> Target Intron 5 >>>> : 169 ||||||||||||||||||||||||||||{|} 223 bp lValAlaGlyThrProGlyArgValPhe{A}++ ++ 54737 : TGTTGCCGGCACACCTGGGCGCGTCTTC{G}gt.........................ag : 54988 170 : {sp}MetIleArgArgArgSerLeuArgThrArgAlaIleLysMetLeuValLeuAspGl : 188 {||}|||||||||||||||||||||||||||||||||||||||||||||||||||||||| {sp}MetIleArgArgArgSerLeuArgThrArgAlaIleLysMetLeuValLeuAspGl 54989 : {AT}ATGATTCGTCGCAGAAGTTTGAGGACTCGAGCTATCAAGATGTTGGTCTTGGATGA : 55046 189 : uAlaAspGluMetLeuAsnLys{G} >>>> Target Intron 6 >>>> {ly}Ph : 197 ||||||||||||||||||||||{|} 2093 bp {||}|| uAlaAspGluMetLeuAsnLys{G}++ ++{ly}Ph 55047 : GGCTGATGAAATGCTGAATAAA{G}gt.........................ag{gt}TT : 57166 198 : eLysGluGlnIleTyrAspValTyrArgTyrLeuProProAlaThrGlnValValLeuIl : 217 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| eLysGluGlnIleTyrAspValTyrArgTyrLeuProProAlaThrGlnValValLeuIl 57167 : CAAGGAGCAGATTTACGATGTGTACAGGTACCTGCCCCCAGCCACGCAGGTGGTGCTCAT : 57226 218 : eSerAlaThrLeuProHisGluIleLeuGluMetThrAsnLysPheMetThrAspProIl : 237 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| eSerAlaThrLeuProHisGluIleLeuGluMetThrAsnLysPheMetThrAspProIl 57227 : CAGTGCCACGCTGCCCCACGAAATCCTGGAGATGACCAACAAGTTCATGACGGACCCCAT : 57286 238 : eArgIleLeuValLys{Ar} >>>> Target Intron 7 >>>> {g}AspGluLe : 246 ||||||||||||||||{||} 369 bp {|}|||||||| eArgIleLeuValLys{Ar}++ ++{g}AspGluLe 57287 : CCGCATCTTGGTGAAA{CG}gt.........................ag{C}GACGAGCT : 57682 247 : uThrLeuGluGlyIleLysGlnPhePheValAlaValGluArgGluGluTrpLysPheAs : 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| uThrLeuGluGlyIleLysGlnPhePheValAlaValGluArgGluGluTrpLysPheAs 57683 : GACACTGGAGGGCATCAAGCAGTTCTTCGTGGCGGTGGAGAGAGAGGAGTGGAAGTTCGA : 57742 267 : pThrLeuCysAspLeuTyrAspThrLeuThrIleThrGlnAlaValIlePheCysAsnTh : 286 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| pThrLeuCysAspLeuTyrAspThrLeuThrIleThrGlnAlaValIlePheCysAsnTh 57743 : CACCCTGTGCGACCTGTACGACACGCTGACCATCACCCAGGCGGTCATCTTCTGCAACAC : 57802 287 : rLysArgLys >>>> Target Intron 8 >>>> ValAspTrpLeuThrGluLys : 296 |||||||||| 599 bp ||||||||||||||||||||| rLysArgLys++ ++ValAspTrpLeuThrGluLys 57803 : CAAGAGGAAGgt.........................agGTTGACTGGTTGACGGAGAAA : 58431 297 : MetArgGluAlaAsnPheThrValSerSerMetHisGlyAspMetProGlnLysGluArg : 316 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MetArgGluAlaAsnPheThrValSerSerMetHisGlyAspMetProGlnLysGluArg 58432 : ATGAGAGAAGCCAACTTCACCGTCTCGTCGATGCACGGAGACATGCCTCAGAAGGAGCGC : 58491 317 : GluSerIleMetLysGluPheArgSerGlyAla{Se} >>>> Target Intron 9 : 328 |||||||||||||||||||||||||||||||||{||} 1213 bp GluSerIleMetLysGluPheArgSerGlyAla{Se}++ 58492 : GAGTCCATCATGAAGGAGTTCCGCTCTGGCGCC{AG}gt..................... : 58531 329 : >>>> {r}ArgValLeuIleSerThrAspValTrpAlaArgGlyLeuAspValProGln : 345 {|}||||||||||||||||||||||||||||||||||||||||||||||||||| ++{r}ArgValLeuIleSerThrAspValTrpAlaArgGlyLeuAspValProGln 58532 : ....ag{C}CGCGTGCTCATTTCAACAGATGTCTGGGCCAGGGGGCTGGATGTCCCTCAG : 59791 346 : ValSerLeuIleIleAsnTyrAspLeuProAsnAsnArgGluLeuTyrIleHis{Ar} : 364 ||||||||||||||||||||||||||||||||||||||||||||||||||||||{||} ValSerLeuIleIleAsnTyrAspLeuProAsnAsnArgGluLeuTyrIleHis{Ar}++ 59792 : GTGTCCCTGATCATTAACTACGACCTGCCGAATAACAGAGAACTGTACATACAC{AG}gt : 59850 365 : >>>> Target Intron 10 >>>> {g}IleGlyArgSerGlyArgTyrGlyArgLy : 374 100 bp {|}||||||||||||||||||||||||||||| ++{g}IleGlyArgSerGlyArgTyrGlyArgLy 59851 : ..........................ag{A}ATCGGGCGGTCGGGCCGGTACGGCCGAAA : 59978 375 : sGlyValAlaIleAsnPheValLysAsnAspAspIleArgIleLeuArgAspIleGluGl : 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| sGlyValAlaIleAsnPheValLysAsnAspAspIleArgIleLeuArgAspIleGluGl 59979 : GGGCGTGGCCATTAATTTCGTGAAGAACGATGACATCCGCATCCTCCGGGACATCGAGCA : 60038 395 : nTyrTyrSerThrGlnIleAspGluMetProMetAsn : 406 ||||||||||||||||||||||||||||||||||||| nTyrTyrSerThrGlnIleAspGluMetProMetAsn 60039 : GTACTACTCCACGCAGATCGACGAGATGCCGATGAAC : 60076 vulgar: SPP00002927_2.0 0 406 . JSZB01021220.1:subseq(63000,63392) 50596 60076 + 1985 M 56 168 S 0 1 5 0 2 I 0 1948 3 0 2 S 1 2 M 23 69 S 0 2 5 0 2 I 0 686 3 0 2 S 1 1 M 22 66 5 0 2 I 0 401 3 0 2 M 21 63 5 0 2 I 0 614 3 0 2 M 44 132 S 0 1 5 0 2 I 0 219 3 0 2 S 1 2 M 26 78 S 0 1 5 0 2 I 0 2089 3 0 2 S 1 2 M 46 138 S 0 2 5 0 2 I 0 365 3 0 2 S 1 1 M 46 138 5 0 2 I 0 595 3 0 2 M 38 114 S 0 2 5 0 2 I 0 1209 3 0 2 S 1 1 M 35 105 S 0 2 5 0 2 I 0 96 3 0 2 S 1 1 M 42 126 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-09 ##type DNA # # # seqname source feature start end score strand frame attributes # JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local gene 50597 60076 1985 + . gene_id 1 ; sequence SPP00002927_2.0 ; gene_orientation + JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 50597 50765 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 50597 50765 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 50766 50767 . + . intron_id 1 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 50766 52717 . + . intron_id 1 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 52716 52717 . + . intron_id 0 ; splice_site "aG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 52718 52790 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 52718 52790 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 52791 52792 . + . intron_id 2 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 52791 53480 . + . intron_id 2 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 53479 53480 . + . intron_id 1 ; splice_site "ag" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 53481 53547 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 53481 53547 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 53548 53549 . + . intron_id 3 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 53548 53952 . + . intron_id 3 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 53951 53952 . + . intron_id 2 ; splice_site "AG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 53953 54015 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 53953 54015 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 54016 54017 . + . intron_id 4 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 54016 54633 . + . intron_id 4 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 54632 54633 . + . intron_id 3 ; splice_site "AG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 54634 54766 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 54634 54766 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 54767 54768 . + . intron_id 5 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 54767 54989 . + . intron_id 5 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 54988 54989 . + . intron_id 4 ; splice_site "AG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 54990 55070 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 54990 55070 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 55071 55072 . + . intron_id 6 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 55071 57163 . + . intron_id 6 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 57162 57163 . + . intron_id 5 ; splice_site "ag" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 57164 57305 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 57164 57305 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 57306 57307 . + . intron_id 7 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 57306 57674 . + . intron_id 7 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 57673 57674 . + . intron_id 6 ; splice_site "AG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 57675 57813 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 57675 57813 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 57814 57815 . + . intron_id 8 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 57814 58412 . + . intron_id 8 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 58411 58412 . + . intron_id 7 ; splice_site "AG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 58413 58528 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 58413 58528 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 58529 58530 . + . intron_id 9 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 58529 59741 . + . intron_id 9 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 59740 59741 . + . intron_id 8 ; splice_site "AG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 59742 59849 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 59742 59849 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice5 59850 59851 . + . intron_id 10 ; splice_site "GT" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local intron 59850 59949 . + . intron_id 10 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local splice3 59948 59949 . + . intron_id 9 ; splice_site "AG" JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local cds 59950 60076 . + . JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local exon 59950 60076 . + . insertions 0 ; deletions 0 JSZB01021220.1:subseq(63000,63392) exonerate:protein2genome:local similarity 50597 60076 1985 + . alignment_id 1 ; Query SPP00002927_2.0 ; Align 50597 1 168 ; Align 52720 58 69 ; Align 53482 82 66 ; Align 53953 104 63 ; Align 54634 125 132 ; Align 54992 170 78 ; Align 57166 197 138 ; Align 57676 244 138 ; Align 58413 290 114 ; Align 59743 329 105 ; Align 59951 365 126 # --- END OF GFF DUMP --- # -- completed exonerate analysis