Command line: [exonerate -m p2g --showtargetgff -q eif4a3_hs.aa.fa.canviat -t genomeeif4a3_JXSJ01000207.1.fa] Hostname: [ws101182u] C4 Alignment: ------------ Query: SPP00002927_2.0 # Protein # eukaryotic translation initiation factor 4A3 (EIF4A3) # Human Target: JXSJ01000207.1:subseq(360532,103709) Miichthys miiuy scaffold207, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 1900 Query range: 7 -> 406 Target range: 53727 -> 49999 8 : AlaThrSerGlySerAlaArgLysArgLeuLeuLysGluGluAspMetThrLysValGlu : 27 |||.!!||| !..!!.!|||||||||||||||!:!|||||||||||||||||||||||| AlaAlaSerThrGlnGlyArgLysArgLeuLeuArgGluGluAspMetThrLysValGlu 53727 : GCTGCCAGTACACAGGGCAGGAAGAGGCTCCTGAGAGAGGAGGATATGACCAAGGTGGAG : 53670 28 : PheGluThrSerGluGluValAspValThrProThrPheAspThrMetGlyLeuArgGlu : 47 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| PheGluThrSerGluGluValAspValThrProThrPheAspThrMetGlyLeuArgGlu 53669 : TTTGAGACTAGCGAGGAGGTGGACGTCACCCCCACCTTCGACACTATGGGCCTCCGGGAG : 53610 48 : AspLeuLeuArgGlyIleTyrAlaTyr{G} >>>> Target Intron 1 >>>> { : 57 |||||||||||||||||||||||||||{|} 580 bp { AspLeuLeuArgGlyIleTyrAlaTyr{G}++ ++{ 53609 : GACCTGCTCCGCGGCATCTACGCTTAC{G}gt.........................ag{ : 52999 58 : ly}PheGluLysProSerAlaIleGlnGlnArgAlaIleLysGlnIleIleLysGlyArg : 76 ||}||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ly}PheGluLysProSerAlaIleGlnGlnArgAlaIleLysGlnIleIleLysGlyArg 52998 : GT}TTCGAGAAGCCTTCAGCCATCCAGCAGAGAGCCATCAAACAGATCATCAAAGGCAGA : 52943 77 : AspValIleAla{Gl} >>>> Target Intron 2 >>>> {n}SerGlnSerGly : 85 ||||||||||||{||} 88 bp {|}|||||||||||| AspValIleAla{Gl}++ ++{n}SerGlnSerGly 52942 : GACGTCATTGCT{CA}gt.........................ag{G}TCCCAGTCCGGT : 52828 86 : ThrGlyLysThrAlaThrPheSerIleSerValLeuGlnCysLeuAspIleGln >>>> : 104 ||||||||||||||||||||| :::||||||||||||||||||||||||||| ThrGlyLysThrAlaThrPheCysValSerValLeuGlnCysLeuAspIleGln++ 52827 : ACCGGAAAGACAGCCaccttctgtgtgtctgtcctgcaGTGTCTCGACATCCAGgt.... : 52769 105 : Target Intron 3 >>>> ValArgGluThrGlnAlaLeuIleLeuAlaProThrA : 116 227 bp ||||||||||||||||||||||||||||||||||||| ++ValArgGluThrGlnAlaLeuIleLeuAlaProThrA 52768 : .....................agGTGAGGGAGACCCAGGCGCTGATCCTCGCTCCAACCA : 52508 117 : rgGluLeuAlaValGlnIleGlnLys >>>> Target Intron 4 >>>> GlyLe : 126 |||||||||||! !|||||||||||| 87 bp ! !|| rgGluLeuAlaGlyGlnIleGlnLys++ ++ValLe 52507 : GAGAGCTGGCTGGACAGATTCAGAAGgt.........................agGTGCT : 52391 127 : uLeuAlaLeuGlyAspTyrMetAsnValGlnCysHisAlaCysIleGlyGlyThrAsnVa : 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| uLeuAlaLeuGlyAspTyrMetAsnValGlnCysHisAlaCysIleGlyGlyThrAsnVa 52390 : GCTGGCTTTGGGAGACTACATGAATGTCCAGTGTCACGCCTGCATCGGGGGCACCAACGT : 52331 147 : lGlyGluAspIleArgLysLeuAspTyrGlyGlnHisValValAlaGlyThrProGlyAr : 166 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| lGlyGluAspIleArgLysLeuAspTyrGlyGlnHisValValAlaGlyThrProGlyAr 52330 : GGGCGAAGACATCCGGAAGCTGGACTATGGTCAGCATGTGGTGGCAGGAACACCTGGACG : 52271 167 : gValPhe{A} >>>> Target Intron 5 >>>> {sp}MetIleArgArgArgSe : 175 |||||||{|} 220 bp {||}||||||||||||||||| gValPhe{A}++ ++{sp}MetIleArgArgArgSe 52270 : TGTGTTT{G}gt.........................ag{AC}ATGATTCGTCGCAGGAG : 52024 176 : rLeuArgThrArgAlaIleLysMetLeuValLeuAspGluAlaAspGluMetLeuAsnLy : 195 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| rLeuArgThrArgAlaIleLysMetLeuValLeuAspGluAlaAspGluMetLeuAsnLy 52023 : TCTGAGAACTAGAGCCATCAAGATGCTCGTCCTGGACGAAGCTGATGAGATGCTGAACAA : 51964 196 : s{G} >>>> Target Intron 6 >>>> {ly}PheLysGluGlnIleTyrAspVa : 204 |{|} 140 bp {||}||||||||||||||||||||||| s{G}++ ++{ly}PheLysGluGlnIleTyrAspVa 51963 : A{G}gt.........................ag{GC}TTTAAGGAGCAGATCTATGATGT : 51797 205 : lTyrArgTyrLeuProProAlaThrGlnValValLeuIleSerAlaThrLeuProHisGl : 224 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| lTyrArgTyrLeuProProAlaThrGlnValValLeuIleSerAlaThrLeuProHisGl 51796 : GTACCGGTACCTGCCTCCAGCCACACAGGTGGTTCTGATCAGCGCCACGCTGCCTCATGA : 51737 225 : uIleLeuGluMetThrAsnLysPheMetThrAspProIleArgIleLeuValLys{Ar} : 243 |||||||||||||||||||||||||||||||||||||||||||||||||||||||{||} uIleLeuGluMetThrAsnLysPheMetThrAspProIleArgIleLeuValLys{Ar}+ 51736 : GATTCTGGAGATGACCAACAAGTTCATGACCGACCCGATCCGCATCCTGGTCAAA{CG}g : 51678 244 : >>>> Target Intron 7 >>>> {g}AspGluLeuThrLeuGluGlyIleLysGl : 253 326 bp {|}||||||||||||||||||||||||||||| + ++{g}AspGluLeuThrLeuGluGlyIleLysGl 51677 : t.........................ag{T}GACGAGCTGACTCTGGAGGGGATCAAACA : 51324 254 : nPhePheValAlaValGluArgGluGluTrpLysPheAspThrLeuCysAspLeuTyrAs : 273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| nPhePheValAlaValGluArgGluGluTrpLysPheAspThrLeuCysAspLeuTyrAs 51323 : GTTCTTTGTtgctgtggagagagaggagtggaagTTTGACACTCTGTGTGATCTGTACGA : 51264 274 : pThrLeuThrIleThrGlnAlaValIlePheCysAsnThrLysArgLys >>>> Targ : 290 ||||||||||||||||||||||||||||||||||||||||||||||||| pThrLeuThrIleThrGlnAlaValIlePheCysAsnThrLysArgLys++ 51263 : TACTCTGACCATCACACAGGCCGTCATCTTCTGTAACACCAAGAGGaaggt......... : 51211 291 : et Intron 8 >>>> ValAspTrpLeuThrGluLysMetArgGluAlaAsnPheThr : 303 109 bp |||||||||||||||||||||||||||||||||||||||||| ++ValAspTrpLeuThrGluLysMetArgGluAlaAsnPheThr 51210 : ................agGTGGACTGGCTAACAGAGAAGATGAGGGAGGCCAACTTCACG : 51065 304 : ValSerSerMetHisGlyAspMetProGlnLysGluArgGluSerIleMetLysGluPhe : 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ValSerSerMetHisGlyAspMetProGlnLysGluArgGluSerIleMetLysGluPhe 51064 : GTGTCCTCGATGCACGGAGACATGCCACAGAAAGAAAGGGAGTCCATCATGAAGGAGTTC : 51005 324 : ArgSerGlyAla{Se} >>>> Target Intron 9 >>>> {r}ArgValLeuIle : 332 ||||||||||||{||} 645 bp {|}|||||||||||| ArgSerGlyAla{Se}++ ++{r}ArgValLeuIle 51004 : AGATCAGGAGCC{AG}gt.........................ag{t}cgTGTTCTGATC : 50333 333 : SerThrAspValTrpAlaArgGlyLeuAspValProGlnValSerLeuIleIleAsnTyr : 352 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| SerThrAspValTrpAlaArgGlyLeuAspValProGlnValSerLeuIleIleAsnTyr 50332 : TCGACCGACGTCTGGGCCCGAGGTTTAGACGTTCCTCAAGTTTCTCTGATCATCAACTAC : 50273 353 : AspLeuProAsnAsnArgGluLeuTyrIleHis{Ar} >>>> Target Intron 10 : 364 |||||||||||||||||||||||||||||||||{||} 109 bp AspLeuProAsnAsnArgGluLeuTyrIleHis{Ar}++ 50272 : GACCTGCCCAACAACAGAGAGCTCTACATTCAC{AG}gt..................... : 50233 365 : >>>> {g}IleGlyArgSerGlyArgTyrGlyArgLysGlyValAlaIleAsnPheVa : 381 {|}|||||||||||||||||||||||||||||||||||||||||||||||||| ++{g}IleGlyArgSerGlyArgTyrGlyArgLysGlyValAlaIleAsnPheVa 50232 : .....ag{G}ATTGGTCGGTCCGGGCGTTATGGCCGTAAGGGTGTGGCCATCAACTTTGT : 50077 382 : lLysAsnAspAspIleArgIleLeuArgAspIleGluGlnTyrTyrSerThrGlnIleAs : 401 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| lLysAsnAspAspIleArgIleLeuArgAspIleGluGlnTyrTyrSerThrGlnIleAs 50076 : GAAGAACGATGACATCAGGATCCTGCGGGACATCGAGCAGTACTACTCCACCCAGATCGA : 50017 402 : pGluMetProMetAsn : 406 |||||||||||||||| pGluMetProMetAsn 50016 : CGAGATGCCCATGAAC : 50000 vulgar: SPP00002927_2.0 7 406 . JXSJ01000207.1:subseq(360532,103709) 53727 49999 - 1900 M 49 147 S 0 1 5 0 2 I 0 576 3 0 2 S 1 2 M 23 69 S 0 2 5 0 2 I 0 84 3 0 2 S 1 1 M 22 66 5 0 2 I 0 223 3 0 2 M 21 63 5 0 2 I 0 83 3 0 2 M 44 132 S 0 1 5 0 2 I 0 216 3 0 2 S 1 2 M 26 78 S 0 1 5 0 2 I 0 136 3 0 2 S 1 2 M 46 138 S 0 2 5 0 2 I 0 322 3 0 2 S 1 1 M 46 138 5 0 2 I 0 105 3 0 2 M 38 114 S 0 2 5 0 2 I 0 641 3 0 2 S 1 1 M 35 105 S 0 2 5 0 2 I 0 105 3 0 2 S 1 1 M 42 126 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2016-11-29 ##type DNA # # # seqname source feature start end score strand frame attributes # JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local gene 50000 53727 1900 - . gene_id 1 ; sequence SPP00002927_2.0 ; gene_orientation + JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 53580 53727 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 53580 53727 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 53578 53579 . - . intron_id 1 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 53000 53579 . - . intron_id 1 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 53000 53001 . - . intron_id 0 ; splice_site "AG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 52927 52999 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 52927 52999 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 52925 52926 . - . intron_id 2 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 52839 52926 . - . intron_id 2 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 52839 52840 . - . intron_id 1 ; splice_site "AG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 52772 52838 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 52772 52838 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 52770 52771 . - . intron_id 3 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 52545 52771 . - . intron_id 3 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 52545 52546 . - . intron_id 2 ; splice_site "AG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 52482 52544 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 52482 52544 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 52480 52481 . - . intron_id 4 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 52395 52481 . - . intron_id 4 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 52395 52396 . - . intron_id 3 ; splice_site "AG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 52262 52394 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 52262 52394 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 52260 52261 . - . intron_id 5 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 52042 52261 . - . intron_id 5 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 52042 52043 . - . intron_id 4 ; splice_site "AG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 51961 52041 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 51961 52041 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 51959 51960 . - . intron_id 6 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 51821 51960 . - . intron_id 6 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 51821 51822 . - . intron_id 5 ; splice_site "AG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 51679 51820 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 51679 51820 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 51677 51678 . - . intron_id 7 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 51353 51678 . - . intron_id 7 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 51353 51354 . - . intron_id 6 ; splice_site "AG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 51214 51352 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 51214 51352 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 51212 51213 . - . intron_id 8 ; splice_site "gt" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 51105 51213 . - . intron_id 8 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 51105 51106 . - . intron_id 7 ; splice_site "ag" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 50989 51104 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 50989 51104 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 50987 50988 . - . intron_id 9 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 50344 50988 . - . intron_id 9 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 50344 50345 . - . intron_id 8 ; splice_site "ag" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 50236 50343 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 50236 50343 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice5 50234 50235 . - . intron_id 10 ; splice_site "GT" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local intron 50127 50235 . - . intron_id 10 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local splice3 50127 50128 . - . intron_id 9 ; splice_site "aG" JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local cds 50000 50126 . - . JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local exon 50000 50126 . - . insertions 0 ; deletions 0 JXSJ01000207.1:subseq(360532,103709) exonerate:protein2genome:local similarity 50000 53727 1900 - . alignment_id 1 ; Query SPP00002927_2.0 ; Align 53728 8 147 ; Align 52998 58 69 ; Align 52838 82 66 ; Align 52545 104 63 ; Align 52395 125 132 ; Align 52040 170 78 ; Align 51819 197 138 ; Align 51352 244 138 ; Align 51105 290 114 ; Align 50343 329 105 ; Align 50126 365 126 # --- END OF GFF DUMP --- # -- completed exonerate analysis