Command line: [exonerate -m p2g --showtargetgff -q TR3/TR3_U.fa -t TR3/SUBSEQ/KB229706.1_1_subseq.txt --exhaustive yes] Hostname: [luke] C4 Alignment: ------------ Query: TR3 Target: KB229706.1:subseq(807941,25134) Odobenus rosmarus divergens isolate Ivan unplaced genomic scaffold Scaffold829, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 272 Query range: 0 -> 66 Target range: 25134 -> 13468 1 : ArgValIleGlyPheHisValLeuGlyProAsnAlaGlyGluValThrGlnGlyPheAla : 20 ||||||:!:||||||||||||||||||||||||||||||||||||||||||||||||||| ArgValValGlyPheHisValLeuGlyProAsnAlaGlyGluValThrGlnGlyPheAla 25134 : CGTGTTGTGGGCTTCCACGTACTGGGTCCAAATGCTGGAGAAGTGACACAAGGCTTTGCA : 25077 21 : AlaAlaMetLysCysGlyLeuThrLysGlnLeuLeuAspAspThrIleGlyIleHisPro : 40 ||||||:!:||||||||||||||||||:!!! !||||||..!|||||||||||||||||| AlaAlaLeuLysCysGlyLeuThrLysLysGlnLeuAspSerThrIleGlyIleHisPro 25076 : GCTGCCCTCAAGTGTGGACTGACCAAAAAGCAGCTGGACAGTACCATTGGAATCCACCCC : 25017 41 : ThrCysGlyGlu >>>> Target Intron 1 >>>> ValPheThrThrLeuGluI : 51 ..!|||!.!||| 11468 bp |||||||||||||||..!: ValCysAlaGlu++ ++ValPheThrThrLeuSerV 25016 : GTCTGTGCAGAGgt.........................agGTATTCACGACTCTGTCGG : 13516 52 : leThrLysSerSerGlyLeuAspIleThrGlnLysGlyCysUnkGly : 66 !:|||||| !!|||||| !..!||| !||| |||||| ||| alThrLysArgSerGlyGlySerIleLeuGlnAlaGlyCys***Gly 13515 : TGACCAAGCGCTCTGGGGGAAGCATCCTCCAGGCCGGCTGCTGAGGT : 13469 vulgar: 0 66 . KB229706.1:subseq(807941,25134) 25134 13468 - 272 M 44 132 5 0 2 I 0 11464 3 0 2 M 22 66 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2015-11-26 ##type DNA # # # seqname source feature start end score strand frame attributes # KB229706.1:subseq(807941,25134) exonerate:protein2genome:local gene 13469 25134 272 - . gene_id 1 ; sequence ; gene_orientation + KB229706.1:subseq(807941,25134) exonerate:protein2genome:local cds 25003 25134 . - . KB229706.1:subseq(807941,25134) exonerate:protein2genome:local exon 25003 25134 . - . insertions 0 ; deletions 0 KB229706.1:subseq(807941,25134) exonerate:protein2genome:local splice5 25001 25002 . - . intron_id 1 ; splice_site "GT" KB229706.1:subseq(807941,25134) exonerate:protein2genome:local intron 13535 25002 . - . intron_id 1 KB229706.1:subseq(807941,25134) exonerate:protein2genome:local splice3 13535 13536 . - . intron_id 0 ; splice_site "AG" KB229706.1:subseq(807941,25134) exonerate:protein2genome:local cds 13469 13534 . - . KB229706.1:subseq(807941,25134) exonerate:protein2genome:local exon 13469 13534 . - . insertions 0 ; deletions 0 KB229706.1:subseq(807941,25134) exonerate:protein2genome:local similarity 13469 25134 272 - . alignment_id 1 ; Query ; Align 25135 1 132 ; Align 13535 45 66 # --- END OF GFF DUMP --- # -- completed exonerate analysis