Command line: [exonerate -m p2g --showtargetgff -q SelW/SelW_U.fa -t SelW/SUBSEQ/KB229136.1_5_subseq.txt --exhaustive yes] Hostname: [luke] C4 Alignment: ------------ Query: SelW Target: KB229136.1:subseq(1070263,25113) Odobenus rosmarus divergens isolate Ivan unplaced genomic scaffold Scaffold259, whole genome shotgun sequence Model: protein2genome:local Raw score: 125 Query range: 0 -> 39 Target range: 24999 -> 25113 1 : AlaLeuThrValArgValIleTyrCysGlyAlaUnkGlyHisLysCysLysTyrLeuLys : 20 |||! !||||||! !|||:!!|||||||||||| |||:!!:!!||| !|||! !||| AlaProThrValThrValValTyrCysGlyAla***GlyTyrGluCysTrpTyrProLys 25000 : GCCCCCACCGTCACGGTTGTTTATTGTGGCGCTTGAGGCTACGAGTGTTGGTACCCTAAG : 25057 21 : LeuLysLysLysLeuGluAspAspValProLysCysLeuAspIleCysGlyGluGly : 39 ||| ||||||:!!||||||!!: !!|||!:!||||||||||||||||||:!!||| Leu---LysLysValGluAspGluPheProArgCysLeuAspIleCysGlyLysGly 25058 : CTC---AAGAAGGTAGAAGATGAGTTCCCCAGATGCCTGGACATCTGCGGCAAGGGC : 25113 vulgar: 0 39 . KB229136.1:subseq(1070263,25113) 24999 25113 + 125 M 21 63 G 1 0 M 17 51 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2015-11-26 ##type DNA # # # seqname source feature start end score strand frame attributes # KB229136.1:subseq(1070263,25113) exonerate:protein2genome:local gene 25000 25113 125 + . gene_id 1 ; sequence ; gene_orientation . KB229136.1:subseq(1070263,25113) exonerate:protein2genome:local cds 25000 25113 . + . KB229136.1:subseq(1070263,25113) exonerate:protein2genome:local exon 25000 25113 . + . insertions 0 ; deletions 1 KB229136.1:subseq(1070263,25113) exonerate:protein2genome:local similarity 25000 25113 125 + . alignment_id 1 ; Query ; Align 25000 1 63 ; Align 25063 23 51 # --- END OF GFF DUMP --- # -- completed exonerate analysis