Command line: [exonerate -m p2g --showtargetgff -q SelS/SelS_U.fa -t SelS/SUBSEQ/KB229132.1_0_subseq.txt --exhaustive yes] Hostname: [luke] C4 Alignment: ------------ Query: SelS Target: KB229132.1:subseq(82896,50086) Odobenus rosmarus divergens isolate Ivan unplaced genomic scaffold Scaffold255, whole genome shotgun sequence Model: protein2genome:local Raw score: 258 Query range: 0 -> 53 Target range: 49231 -> 50086 1 : MetGluArgAspGlyGlnGlnLeuSerAlaArgProAlaLeuGluThrGluGlyLeuArg : 20 ||||||||||||||||||! !|||||||||||||||||||||||||||||||||!!!||| MetGluArgAspGlyGlnLeuLeuSerAlaArgProAlaLeuGluThrGluGlyPheArg 49232 : ATGGAGCGGGACGGGCAGCTGCTGTCCGCGCGGCCGGCCCTGGAGACGGAGGGGTTTCGC : 49289 21 : PheLeuHisValThr{V} >>>> Target Intron 1 >>>> {al}GlySerLeu : 29 !:!||||||||||||{|} 696 bp {||}||||||||| TyrLeuHisValThr{V}++ ++{al}GlySerLeu 49290 : TACCTGCACGTCACG{G}gt.........................ag{tg}ggctccctg : 50012 30 : LeuAlaThrTyrGlyTrpTyrIleValPheSerCysIleLeuLeuTyrValValPheGln : 49 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| LeuAlaThrTyrGlyTrpTyrIleValPheSerCysIleLeuLeuTyrValValPheGln 50013 : ctagcCACTTACGGCTGGTACATCGTCTTCAGCTGCATCCTTCTCTACGTGGTGTTTCAG : 50072 50 : LysLeuSerThr : 53 |||||||||||| LysLeuSerThr 50073 : AAGCTTTCCACC : 50086 vulgar: 0 53 . KB229132.1:subseq(82896,50086) 49231 50086 + 258 M 25 75 S 0 1 5 0 2 I 0 692 3 0 2 S 1 2 M 27 81 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2015-11-27 ##type DNA # # # seqname source feature start end score strand frame attributes # KB229132.1:subseq(82896,50086) exonerate:protein2genome:local gene 49232 50086 258 + . gene_id 1 ; sequence ; gene_orientation + KB229132.1:subseq(82896,50086) exonerate:protein2genome:local cds 49232 49307 . + . KB229132.1:subseq(82896,50086) exonerate:protein2genome:local exon 49232 49307 . + . insertions 0 ; deletions 0 KB229132.1:subseq(82896,50086) exonerate:protein2genome:local splice5 49308 49309 . + . intron_id 1 ; splice_site "GT" KB229132.1:subseq(82896,50086) exonerate:protein2genome:local intron 49308 50003 . + . intron_id 1 KB229132.1:subseq(82896,50086) exonerate:protein2genome:local splice3 50002 50003 . + . intron_id 0 ; splice_site "ag" KB229132.1:subseq(82896,50086) exonerate:protein2genome:local cds 50004 50086 . + . KB229132.1:subseq(82896,50086) exonerate:protein2genome:local exon 50004 50086 . + . insertions 0 ; deletions 0 KB229132.1:subseq(82896,50086) exonerate:protein2genome:local similarity 49232 50086 258 + . alignment_id 1 ; Query ; Align 49232 1 75 ; Align 50006 27 81 # --- END OF GFF DUMP --- # -- completed exonerate analysis