Command line: [exonerate -m p2g --showtargetgff -q SelR1/SelR1_U.fa -t SelR1/SUBSEQ/KB229056.1_1_subseq.txt --exhaustive yes] Hostname: [luke] C4 Alignment: ------------ Query: SelR1 Target: KB229056.1:subseq(1658230,25122) Odobenus rosmarus divergens isolate Ivan unplaced genomic scaffold Scaffold179, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 208 Query range: 61 -> 102 Target range: 25122 -> 24999 62 : HisValSerCysGlyArgCysGlyAsnGlyLeuGlyHisGluPheLeuAsnAspGlyPro : 81 !!.||||||||||||!:!|||||||||||||||||||||||||||||||||||||||||| GlnValSerCysGlyLysCysGlyAsnGlyLeuGlyHisGluPheLeuAsnAspGlyPro 25122 : CAGGTGTCCTGCGGCAAATGTGGGAACGGGCTGGGCCATGAGTTCCTGAATGATGGCCCC : 25065 82 : LysProGlyGlnSerArgPheUnkIlePheSerSerSerLeuLysPheIleProLysGly : 101 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| LysProGlyGlnSerArgPhe***IlePheSerSerSerLeuLysPheIleProLysGly 25064 : AAGCCGGGGCAGTCCCGCTTCTGAATATTTAGCAGTTCGCTGAAGTTCATCCCGAAAGGT : 25005 102 : Glu : 102 ||| Glu 25004 : GAG : 25000 vulgar: 61 102 . KB229056.1:subseq(1658230,25122) 25122 24999 - 208 M 41 123 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2015-11-26 ##type DNA # # # seqname source feature start end score strand frame attributes # KB229056.1:subseq(1658230,25122) exonerate:protein2genome:local gene 25000 25122 208 - . gene_id 1 ; sequence ; gene_orientation . KB229056.1:subseq(1658230,25122) exonerate:protein2genome:local cds 25000 25122 . - . KB229056.1:subseq(1658230,25122) exonerate:protein2genome:local exon 25000 25122 . - . insertions 0 ; deletions 0 KB229056.1:subseq(1658230,25122) exonerate:protein2genome:local similarity 25000 25122 208 - . alignment_id 1 ; Query ; Align 25123 62 123 # --- END OF GFF DUMP --- # -- completed exonerate analysis