Command line: [exonerate -m p2g --showtargetgff -q SecSn/SecSn_U.fa -t SecSn/SUBSEQ/KB229054.1_7_subseq.txt --exhaustive yes] Hostname: [luke] C4 Alignment: ------------ Query: SecS Target: KB229054.1:subseq(3259804,25068) Odobenus rosmarus divergens isolate Ivan unplaced genomic scaffold Scaffold177, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 700 Query range: 221 -> 368 Target range: 25068 -> 1284 222 : ValGluValSerLysHisAsnValGlyPheThrCysPheHisCysTyrLeuHisPhePhe : 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ValGluValSerLysHisAsnValGlyPheThrCysPheHisCysTyrLeuHisPhePhe 25068 : GTAGAAGTTTCTAAGCATAATGTTGGATTTACTTGTTTTCATTGCtatctccatttcttt : 25011 242 : AspLeuThr >>>> Target Intron 1 >>>> SerLeuAspLysAsnPheMetV : 252 |||...||| 9759 bp |||||||||||||||||||||| AspPheThr++ ++SerLeuAspLysAsnPheMetV 25010 : gattttacagt.........................agAGCTTGGACAAAAATTTTATGG : 15219 253 : alProValGlyGlyAlaIleIleAlaGlyPheAsnAspSerPheIleGlnGluIleSerL : 272 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| alProValGlyGlyAlaIleIleAlaGlyPheAsnAspSerPheIleGlnGluIleSerL 15218 : TTCCGGTAGGTGGCGCTATAATTGCTGGCTTTAATGATTCCTTCATTCAGGAAATCAGCA : 15159 273 : ysMetTyrPro{G} >>>> Target Intron 2 >>>> {ly}ArgAlaSerAlaS : 281 |||||||||||{|} 136 bp {||}||||||||||||| ysMetTyrPro{G}++ ++{ly}ArgAlaSerAlaS 15158 : AGATGTATCCA{G}gt.........................ag{GA}AGAGCTTCAGCTT : 14996 282 : erProSerLeuAspValLeuIleThrLeuLeuSerLeuGlySerAsnGlyTyrLysLysL : 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| erProSerLeuAspValLeuIleThrLeuLeuSerLeuGlySerAsnGlyTyrLysLysL 14995 : CACCTTCTTTAGATGTCCTTATTACTTTATTATCACTTGGATCAAATGGCTAtaagaaac : 14936 302 : euLeuLysGluArgLys >>>> Target Intron 3 >>>> GluMetPheSerTy : 311 ||||||||||||||||| 10073 bp |||||||||||||| euLeuLysGluArgLys++ ++GluMetPheSerTy 14935 : tattaaaagaaaggaaggt.........................agGAGATGTTTTCATA : 4833 312 : rLeuSerSerGlnLeuLysLysLeuSerGluThrTyrAsnGluArgLeuLeuHisThrPr : 331 |||||||||||||||||||||||||||||||!.!|||||||||||||||||||||||||| rLeuSerSerGlnLeuLysLysLeuSerGluAsnTyrAsnGluArgLeuLeuHisThrPr 4832 : CTTGTCCAGCCAACTAAAGAAGCTGTCAGAAAACTACAACGAAAGGCTGTTGCATACACC : 4773 332 : oHisAsnProIleSerLeu{A} >>>> Target Intron 4 >>>> {la}MetTh : 340 |||||||||||||||||||{|} 1981 bp {||}::!|| oHisAsnProIleSerLeu{A}++ ++{la}ValTh 4772 : TCACAATCCCATATCTTTA{G}gt.........................ag{ct}gtGAC : 2765 341 : rLeuLysThrLeuGlyGluAspGluAspLysAlaValThrGlnLeuGlySerMetLeuPh : 360 ||||||||||||||||||| !!:!!|||!:!|||:!!||||||||||||||||||||||| rLeuLysThrLeuGlyGluHisGlnAspArgAlaIleThrGlnLeuGlySerMetLeuPh 2764 : ACTTAAGACACTAGGTGAACACCAAGACAGAGCTATCACTCAGCTTGGCTCAATGCTTTT : 2705 361 : eThrArgGlnValSerGlyAla{Ar} >>>> Target Intron 5 >>>> {g} : 368 ||||||||||||||||||||||{||} 1394 bp {|} eThrArgGlnValSerGlyAla{Ar}++ ++{g} 2704 : TACTAGACAGGTTTCTGGAGCC{AG}gt.........................ag{G} : 1285 vulgar: 221 368 . KB229054.1:subseq(3259804,25068) 25068 1284 - 700 M 23 69 5 0 2 I 0 9755 3 0 2 M 31 93 S 0 1 5 0 2 I 0 132 3 0 2 S 1 2 M 30 90 5 0 2 I 0 10069 3 0 2 M 31 93 S 0 1 5 0 2 I 0 1977 3 0 2 S 1 2 M 29 87 S 0 2 5 0 2 I 0 1390 3 0 2 S 1 1 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2015-11-26 ##type DNA # # # seqname source feature start end score strand frame attributes # KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local gene 1285 25068 700 - . gene_id 1 ; sequence ; gene_orientation + KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local cds 25000 25068 . - . KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local exon 25000 25068 . - . insertions 0 ; deletions 0 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice5 24998 24999 . - . intron_id 1 ; splice_site "GT" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local intron 15241 24999 . - . intron_id 1 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice3 15241 15242 . - . intron_id 0 ; splice_site "AG" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local cds 15147 15240 . - . KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local exon 15147 15240 . - . insertions 0 ; deletions 0 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice5 15145 15146 . - . intron_id 2 ; splice_site "GT" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local intron 15011 15146 . - . intron_id 2 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice3 15011 15012 . - . intron_id 1 ; splice_site "AG" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local cds 14919 15010 . - . KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local exon 14919 15010 . - . insertions 0 ; deletions 0 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice5 14917 14918 . - . intron_id 3 ; splice_site "gt" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local intron 4846 14918 . - . intron_id 3 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice3 4846 4847 . - . intron_id 2 ; splice_site "AG" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local cds 4752 4845 . - . KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local exon 4752 4845 . - . insertions 0 ; deletions 0 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice5 4750 4751 . - . intron_id 4 ; splice_site "gt" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local intron 2771 4751 . - . intron_id 4 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice3 2771 2772 . - . intron_id 3 ; splice_site "ag" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local cds 2680 2770 . - . KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local exon 2680 2770 . - . insertions 0 ; deletions 0 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice5 2678 2679 . - . intron_id 5 ; splice_site "GT" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local intron 1286 2679 . - . intron_id 5 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local splice3 1286 1287 . - . intron_id 4 ; splice_site "AG" KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local utr3b 1285 1285 . - . KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local exon 1285 1285 . - . insertions 0 ; deletions 0 KB229054.1:subseq(3259804,25068) exonerate:protein2genome:local similarity 1285 25068 700 - . alignment_id 1 ; Query ; Align 25069 222 69 ; Align 15241 245 93 ; Align 15009 277 90 ; Align 4846 307 93 ; Align 2769 339 87 # --- END OF GFF DUMP --- # -- completed exonerate analysis