Command line: [exonerate -m p2g --showtargetgff -q SelW1/SelW1_U.fa -t SelW1/SUBSEQ/KB229003.1_0_subseq.txt --exhaustive yes] Hostname: [luke] C4 Alignment: ------------ Query: SelW1 Target: KB229003.1:subseq(198843,25074) Odobenus rosmarus divergens isolate Ivan unplaced genomic scaffold Scaffold126, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 253 Query range: 36 -> 87 Target range: 25074 -> 24833 37 : CysGlyGluGlyThrProGlnAlaThrGlyPhePheGluValMetValAlaGlyLysLeu : 56 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CysGlyGluGlyThrProGlnAlaThrGlyPhePheGluValMetValAlaGlyLysLeu 25074 : TGTGGCGAGGGGACTCCCCAGGCCACCGGCTTCTTCGAAGTGATGGTAGCCGGGAAGCTG : 25017 57 : IleHisSerLysLys >>>> Target Intron 1 >>>> LysGlyAspGlyTyrV : 67 :!!|||||||||||| 88 bp :::||||||||||||| ValHisSerLysLys++ ++ArgGlyAspGlyTyrV 25016 : GTTCACTCCAAGAAGgt.........................agagaGGTGATGGCTACG : 24896 68 : alAspThrGluSerLysPheLeuLysLeuValAlaAlaIleLysAlaAlaLeuAlaGlnG : 87 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| alAspThrGluSerLysPheLeuLysLeuValAlaAlaIleLysAlaAlaLeuAlaGlnG 24895 : TGGACACAGAGAGCAAGTTTCTGAAGCTGGTGGCAGCCATCAAGGCCGCCTTGGCTCAGG : 24836 88 : ly : 87 || ly 24835 : GC : 24834 vulgar: 36 87 . KB229003.1:subseq(198843,25074) 25074 24833 - 253 M 25 75 5 0 2 I 0 84 3 0 2 M 26 78 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2015-11-25 ##type DNA # # # seqname source feature start end score strand frame attributes # KB229003.1:subseq(198843,25074) exonerate:protein2genome:local gene 24834 25074 253 - . gene_id 1 ; sequence ; gene_orientation + KB229003.1:subseq(198843,25074) exonerate:protein2genome:local cds 25000 25074 . - . KB229003.1:subseq(198843,25074) exonerate:protein2genome:local exon 25000 25074 . - . insertions 0 ; deletions 0 KB229003.1:subseq(198843,25074) exonerate:protein2genome:local splice5 24998 24999 . - . intron_id 1 ; splice_site "GT" KB229003.1:subseq(198843,25074) exonerate:protein2genome:local intron 24912 24999 . - . intron_id 1 KB229003.1:subseq(198843,25074) exonerate:protein2genome:local splice3 24912 24913 . - . intron_id 0 ; splice_site "ag" KB229003.1:subseq(198843,25074) exonerate:protein2genome:local cds 24834 24911 . - . KB229003.1:subseq(198843,25074) exonerate:protein2genome:local exon 24834 24911 . - . insertions 0 ; deletions 0 KB229003.1:subseq(198843,25074) exonerate:protein2genome:local similarity 24834 25074 253 - . alignment_id 1 ; Query ; Align 25075 37 75 ; Align 24912 62 78 # --- END OF GFF DUMP --- # -- completed exonerate analysis