BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= SPS00000013_1.0 # SECIS # Selenoprotein N (SelN) # Homo sapiens
# Complete # Forward
         (86 letters)

Database: /cursos/BI/genomes/project_2013/Saimiri_boliviensis/genome.f
a 
           2685 sequences; 2,608,572,064 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|JH378173.1| Saimiri boliviensis boliviensis unplaced genomic ...   127   8e-28
gb|JH378136.1| Saimiri boliviensis boliviensis unplaced genomic ...   100   2e-19

>gb|JH378173.1| Saimiri boliviensis boliviensis unplaced genomic scaffold scaffold00069,
              whole genome shotgun sequence
          Length = 12712817

 Score =  127 bits (64), Expect = 8e-28
 Identities = 73/76 (96%)
 Strand = Plus / Minus

                                                                          
Query: 9      tccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccagcttgatgt 68
              ||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||
Sbjct: 940358 tccccggcagcagccccatgatggctggatctgaaatccttgatgggtccagcttgatgt 940299

                              
Query: 69     ctttgcagctgcacct 84
              ||||||||||||||||
Sbjct: 940298 ctttgcagctgcacct 940283


>gb|JH378136.1| Saimiri boliviensis boliviensis unplaced genomic scaffold scaffold00032,
                whole genome shotgun sequence
          Length = 21366645

 Score = 99.6 bits (50), Expect = 2e-19
 Identities = 77/86 (89%), Gaps = 5/86 (5%)
 Strand = Plus / Plus

                                                                            
Query: 4        tggcttccccggcagcagc-----cccatgatggctgaatccgaaatcctcgatgggtcc 58
                |||||||||| ||||||||     ||||||||||||| ||| |||||||| |||||||||
Sbjct: 15324187 tggcttccccagcagcagccccatcccatgatggctggatctgaaatccttgatgggtcc 15324246

                                          
Query: 59       agcttgatgtctttgcagctgcacct 84
                ||||||||||||||||||||||||||
Sbjct: 15324247 agcttgatgtctttgcagctgcacct 15324272


  Database: /cursos/BI/genomes/project_2013/Saimiri_boliviensis/genome
  .fa
    Posted date:  Oct 24, 2012  8:25 PM
  Number of letters in database: 2,608,572,064
  Number of sequences in database:  2685
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 84,820
Number of Sequences: 2685
Number of extensions: 84820
Number of successful extensions: 27
Number of sequences better than 1.0e-03: 2
Number of HSP's better than  0.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24
Number of HSP's gapped (non-prelim): 3
length of query: 86
length of database: 2,608,572,064
effective HSP length: 19
effective length of query: 67
effective length of database: 2,608,521,049
effective search space: 174770910283
effective search space used: 174770910283
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 24 (48.1 bits)