Command line: [exonerate -m p2g --showtargetgff -q SPP00000031_1.0.fa -t SPP00000031_1.0.GL397430.1/GL397430.1.subseq] Hostname: [upf-OptiPlex-755] C4 Alignment: ------------ Query: SPP00000031_1.0 # Protein # Selenoprotein W2 (SelW2) # Homo sapiens # Complete Target: GL397430.1:subseq(1517782,104411) dna:supercontig supercontig:Nleu1.0:GL397430.1:1:2993044:1 REF:[revcomp] Model: protein2genome:local Raw score: 433 Query range: 0 -> 115 Target range: 54411 -> 49999 1 : MetSerGlyGluProGlyGlnThrSerValAlaProProProGluGluValGluProGly : 20 |||||||||||||||||||||||||||||||||||||||! !|||||||||||||||||| MetSerGlyGluProGlyGlnThrSerValAlaProProHisGluGluValGluProGly 54411 : ATGAGCGGGGAGCCGGGGCAGACGTCCGTAGCGCCCCCTCACGAGGAGGTCGAGCCGGGC : 54354 21 : SerGlyValArgIleValValGluTyr{Cy} >>>> Target Intron 1 >>>> : 30 |||||||||||||||||||||||||||{||} 115 bp SerGlyValArgIleValValGluTyr{Cy}++ ++ 54353 : AGTGGGGTCCGCATCGTGGTGGAGTAC{TG}gt.........................ag : 54209 31 : {s}GluProCysGlyPheGluAlaThrTyrLeuGluLeuAlaSerAlaValLysGluGln : 49 {|}||||||||||||||||||||||||||||||||||||||||||... {s}GluProCysGlyPheGluAlaThrTyrLeuGluLeuAlaSerUnkUnkUnkUnkUnk 54208 : {T}GAACCCTGCGGCTTCGAGGCGACCTACCTGGAGCTGGCCAGTNNNNNNNNNNNNNNN : 54152 50 : TyrProGlyIleGluIleGluSerArgLeuGlyGlyThr{G} >>>> Target Intr : 63 ... ...{ } 3866 bp UnkUnkUnkUnkUnkUnkUnkUnkUnkUnkUnkUnkUnk{U}-- 54151 : NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN{N}nn................ : 54107 64 : on 2 >>>> {ly}AlaPheGluIleGluIleAsnGlyGlnLeuValPheSerLysLeu : 78 {!!}||||||||||||||||||||||||||||||||||||||||||||| ++{nk}AlaPheGluIleGluIleAsnGlyGlnLeuValPheSerLysLeu 54106 : .........ag{GT}GCCTTTGAGATAGAGATAAATGGACAGCTGGTGTTCTCCAAGCTG : 50199 79 : GluAsnGlyGlyPheProTyrGluLysAsp >>>> Target Intron 3 >>>> L : 89 |||||||||||||||||||||||||||||| 86 bp | GluAsnGlyGlyPheProTyrGluLysAsp++ ++L 50198 : GAGAATGGGGGCTTTCCCTATGAGAAAGATgt.........................agC : 50080 90 : euIleGluAlaIleArgArgAlaSerAsnGlyGluThrLeuGluLysIleThrAsnSerA : 109 ||||||||||||||||||||||||||||||||||| !!|||||||||||||||||||||| euIleGluAlaIleArgArgAlaSerAsnGlyGluProLeuGluLysIleThrAsnSerA 50079 : TCATTGAGGCCATCCGAAGAGCCAGTAACGGAGAACCCCTAGAAAAGATCACCAACAGCC : 50020 110 : rgProProCysValIleLeu : 115 |||||||||||||||||||| rgProProCysValIleLeu 50019 : GTCCTCCGTGCGTCATCCTG : 50000 vulgar: SPP00000031_1.0 0 115 . GL397430.1:subseq(1517782,104411) 54411 49999 - 433 M 29 87 S 0 2 5 0 2 I 0 111 3 0 2 S 1 1 M 32 96 S 0 1 5 0 2 I 0 3862 3 0 2 S 1 2 M 25 75 5 0 2 I 0 82 3 0 2 M 27 81 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2012-12-04 ##type DNA # # # seqname source feature start end score strand frame attributes # GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local gene 50000 54411 433 - . gene_id 1 ; sequence SPP00000031_1.0 ; gene_orientation + GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local cds 54323 54411 . - . GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local exon 54323 54411 . - . insertions 0 ; deletions 0 GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local splice5 54321 54322 . - . intron_id 1 ; splice_site "GT" GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local intron 54208 54322 . - . intron_id 1 GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local splice3 54208 54209 . - . intron_id 0 ; splice_site "AG" GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local cds 54110 54207 . - . GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local exon 54110 54207 . - . insertions 0 ; deletions 0 GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local splice5 54108 54109 . - . intron_id 2 ; splice_site "NN" GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local intron 50244 54109 . - . intron_id 2 GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local splice3 50244 50245 . - . intron_id 1 ; splice_site "AG" GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local cds 50167 50243 . - . GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local exon 50167 50243 . - . insertions 0 ; deletions 0 GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local splice5 50165 50166 . - . intron_id 3 ; splice_site "GT" GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local intron 50081 50166 . - . intron_id 3 GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local splice3 50081 50082 . - . intron_id 2 ; splice_site "AG" GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local cds 50000 50080 . - . GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local exon 50000 50080 . - . insertions 0 ; deletions 0 GL397430.1:subseq(1517782,104411) exonerate:protein2genome:local similarity 50000 54411 433 - . alignment_id 1 ; Query SPP00000031_1.0 ; Align 54412 1 87 ; Align 54207 31 96 ; Align 50242 64 75 ; Align 50081 89 81 # --- END OF GFF DUMP --- # -- completed exonerate analysis