Command line: [exonerate -m p2g --showtargetgff -q querys/Leishmania_mexicana.prot1.fa -t donovani36cut.fa -E] Hostname: [luke] C4 Alignment: ------------ Query: Lmsel1.Leishmania_mexicana located on mex120l07.p1k:subseq(28600,1200) [translate(1)] Target: contig_36:subseq(2370043,20236) [revcomp] Model: protein2genome:local Raw score: 248 Query range: 43 -> 120 Target range: 10272 -> 10038 44 : GlnArgAlaThrGlyArgGlnThrAlaLysLysLys<->ArgValSerValSerThrThr : 62 ||||||.!!|||.!!|||||||||||||||:!!!:! ..! ! !! !!||||||! ! GlnArgThrThrSerArgGlnThrAlaLysGlnArgAsnGluTyrProPheSerThrIle 10272 : CAACGCACCACAAGCAGGCAGACAGCCAAACAAAGAAACGAGTATCCGTTTTCTACGATT : 10215 63 : LeuLeuIleMetAspLeuUnkGluAsnTrpArgIleAlaLeuTyrPheValLeuAlaVal : 82 |||||||||||||||||| ||||||||||||! !|||||||||||||||||||||||| LeuLeuIleMetAspLeu***GluAsnTrpArgThrAlaLeuTyrPheValLeuAlaVal 10214 : TTGCTGATTATGGACCTGTGAGAGAACTGGCGCACCGCCCTCTACTTCGTGCTTGCCGTA : 10155 83 : CysArgSerSerHisSerProSerSerLeuAlaThrThrValLeuArgGlnGlnProPro : 102 ! |||||||||||||||||||||||||||||| !!.!!||||||!.!||| !|||||| ArgArgSerSerHisSerProSerSerLeuAlaProAlaValLeuHisGlnLeuProPro 10154 : AGAAGATCTTCACACTCACCCTCATCGCTGGCGCCGGCTGTTCTTCACCAATTGCCTCCC : 10095 103 : LeuAlaProLeuLeuAlaAlaLeuCysPheTyrLysUnkThrAlaAlaAlaAla : 120 |||!.!! !||||||||||||||||||||||||!.....||||||||||||||| LeuValLeuLeuLeuAlaAlaLeuCysPheTyrSerSerThrAlaAlaAlaAla 10094 : CTAGTACTTCTCCTCGCTGCGTTGTGTTTCTACAGCTCAACCGCTGCAGCAGCG : 10039 vulgar: Lmsel1.Leishmania_mexicana 43 120 . contig_36:subseq(2370043,20236) 10272 10038 - 248 M 12 36 G 0 3 M 65 195 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2012-01-04 ##type DNA # # # seqname source feature start end score strand frame attributes # contig_36:subseq(2370043,20236) exonerate:protein2genome:local gene 10039 10272 248 - . gene_id 1 ; sequence Lmsel1.Leishmania_mexicana ; gene_orientation . contig_36:subseq(2370043,20236) exonerate:protein2genome:local cds 10039 10272 . - . contig_36:subseq(2370043,20236) exonerate:protein2genome:local exon 10039 10272 . - . insertions 3 ; deletions 0 contig_36:subseq(2370043,20236) exonerate:protein2genome:local similarity 10039 10272 248 - . alignment_id 1 ; Query Lmsel1.Leishmania_mexicana ; Align 10273 44 36 ; Align 10234 56 195 # --- END OF GFF DUMP --- # C4 Alignment: ------------ Query: Lmsel1.Leishmania_mexicana located on mex120l07.p1k:subseq(28600,1200) [translate(1)] Target: contig_36:subseq(2370043,20236) [revcomp] Model: protein2genome:local Raw score: 156 Query range: 0 -> 82 Target range: 10339 -> 1280 1 : MetArgAlaLeuSerHisThrGlyThrCysSerAspIleAlaValGluValThrGluSer : 20 ||||||!.!||| !!||||||||||||||||||||||||||||||!!:!.!||||||||| MetArgValLeuArgHisThrGlyThrCysSerAspIleAlaValAspAlaThrGluSer 10339 : ATGCGTGTGCTGCGCCACACAGGCACATGCAGCGACATTGCCGTAGACGCTACAGAATCA : 10282 21 : SerValAlaThrArgHisArgGlnAlaAspSerGlnLysLysThrSerIleArg<->Phe : 39 |||!.!||||||!.!|||!:!|||||||||||||||! !|||! ! !!:!! ! ||| SerAlaAlaThrHisHisLysGlnAlaAspSerGlnThrLysLysArgValSerValPhe 10281 : TCCGCAGCAACGCACCACAAGCAGGCAGACAGCCAAACAAAGAAACGAGTATCCGTTTTC : 10222 40 : TyrTyrPheAlaGlnArgAlaThr >>>> Target Intron 1 >>>> GlyArgG : 50 ||| !!||||||.!. !!.! !! 8810 bp |||||| TyrAspPheAlaAspTyrGlyPro++ ++GlyArgV 10221 : TACGATTTTGCTGATTATGGACCTgt.........................agGGCCGGG : 1379 51 : lnThrAlaLysLysLysArgValSerValSerThrThrLeuLeuIleMetAspLeuUnkG : 70 !..!:!!::: !..!|||:!!:!!|||!!! ! !|||:!! !:!!! !||| alValSerArgProSerArgIleAlaValCysTrpArgLeuValAspLeuAlaLeuIleP 1378 : TGGTGTCGCGCCCGTCGCGCATCGCCGTCTGCTGGCGCTTGGTGGATTTGGCTCTCATTT : 1319 71 : luAsnTrpArgIleAlaLeuTyrPheValLeuAlaVal : 82 ! ! ! ||||||||||||:!!:!!:!!:!! heIleProValAlaAlaLeuTyrPheIleMetSerLeu 1318 : TCATTCCTGTGGCGGCTCTGTACTTCATCATGTCGCTG : 1281 vulgar: Lmsel1.Leishmania_mexicana 0 82 . contig_36:subseq(2370043,20236) 10339 1280 - 156 M 38 114 G 0 3 M 9 27 5 0 2 I 0 8806 3 0 2 M 35 105 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2012-01-04 ##type DNA # # # seqname source feature start end score strand frame attributes # contig_36:subseq(2370043,20236) exonerate:protein2genome:local gene 1281 10339 156 - . gene_id 2 ; sequence Lmsel1.Leishmania_mexicana ; gene_orientation + contig_36:subseq(2370043,20236) exonerate:protein2genome:local cds 10196 10339 . - . contig_36:subseq(2370043,20236) exonerate:protein2genome:local exon 10196 10339 . - . insertions 3 ; deletions 0 contig_36:subseq(2370043,20236) exonerate:protein2genome:local splice5 10194 10195 . - . intron_id 1 ; splice_site "GT" contig_36:subseq(2370043,20236) exonerate:protein2genome:local intron 1386 10195 . - . intron_id 1 contig_36:subseq(2370043,20236) exonerate:protein2genome:local splice3 1386 1387 . - . intron_id 0 ; splice_site "AG" contig_36:subseq(2370043,20236) exonerate:protein2genome:local cds 1281 1385 . - . contig_36:subseq(2370043,20236) exonerate:protein2genome:local exon 1281 1385 . - . insertions 0 ; deletions 0 contig_36:subseq(2370043,20236) exonerate:protein2genome:local similarity 1281 10339 156 - . alignment_id 2 ; Query Lmsel1.Leishmania_mexicana ; Align 10340 1 114 ; Align 10223 39 27 ; Align 1386 48 105 # --- END OF GFF DUMP --- # -- completed exonerate analysis