Command line: [exonerate -m p2g --showtargetgff -q MrsAaureococcus4.fa -t fastasubseq3.fa] Hostname: [localhost.localdomain] C4 Alignment: ------------ Query: MsrA.Aureococcus_anophagefferens.3 located on scaffold_4 strand + positions 1209101,1209514 Target: gi|288565139|gb|GG744058.1|:subseq(1400,1000) Saprolegnia parasitica CBS 223.65 genomic scaffold supercont1.176, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 125 Query range: 78 -> 138 Target range: 240 -> 60 79 : AsnLysGlySerArgGlnTyrArgSerAlaIlePheTyrHisAspGluAlaGlnArgGluCysA : 100 ||| ! ! !.!!! !||||||||||||!.!|||!:!||||||..!!!:! !||||||||| !| AsnAspValGlyThrGlnTyrArgSerGlyIleTyrTyrHisSerAspGluGlnArgGluIleA 240 : AACGACGTTGGCACGCAATACCGCTCCGGGATCTACTACCACAGTGACGAGCAGCGCGAGATCG : 177 101 : laGluArgValGlnAlaGlnLeuPheProSerLysArgTyrValArgAspThrAlaIleGluPr : 121 ||||| !:!!:!! !.!. ! ! !!:! ! !! !! !! !! |||! !|||||||| laGluAlaIleLysArgAspGluAlaAspAsnPheProSerGluIleValThrGluIleGluPr 176 : CCGAGGCCATCAAACGCGATGAAGCTGACAACTTTCCATCCGAGATTGTGACCGAGATCGAGCC : 114 122 : oAlaAlaGluPhePheProAlaGluAlaTyrHisGlnLysTyrArgGluLys : 138 ||||!.! !|||!:!! !||||||! !|||||||||:::|||! !|||||| oAlaGlyProPheTyrHisAlaGluGluTyrHisGlnArgTyrLeuGluLys 113 : CGCAGGTCCGTTCTACCACGCGGAAGAGTACCACCAGCGCTACCTCGAGAAA : 61 vulgar: MsrA.Aureococcus_anophagefferens.3 78 138 . gi|288565139|gb|GG744058.1|:subseq(1400,1000) 240 60 - 125 M 60 180 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2011-03-04 ##type DNA # # # seqname source feature start end score strand frame attributes # gi|288565139|gb|GG744058.1|:subseq(1400,1000) exonerate:protein2genome:local gene 61 240 125 - . gene_id 1 ; sequence MsrA.Aureococcus_anophagefferens.3 ; gene_orientation . gi|288565139|gb|GG744058.1|:subseq(1400,1000) exonerate:protein2genome:local cds 61 240 . - . gi|288565139|gb|GG744058.1|:subseq(1400,1000) exonerate:protein2genome:local exon 61 240 . - . insertions 0 ; deletions 0 gi|288565139|gb|GG744058.1|:subseq(1400,1000) exonerate:protein2genome:local similarity 61 240 125 - . alignment_id 1 ; Query MsrA.Aureococcus_anophagefferens.3 ; Align 241 79 180 # --- END OF GFF DUMP --- # -- completed exonerate analysis