BLASTN 2.2.17 [Aug-26-2007]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= trna yoelii
         (89 letters)

Database: genome.fa 
           2960 sequences; 20,171,213 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Plasmodium_yoelii_yoelii_str._17XNL|MALPY00618|2002-09-10|ds-DNA...   176   8e-45
Plasmodium_yoelii_yoelii_str._17XNL|MALPY01782|2002-09-10|ds-DNA...    34   0.076
Plasmodium_yoelii_yoelii_str._17XNL|MALPY01406|2002-09-10|ds-DNA...    30   1.2  
Plasmodium_yoelii_yoelii_str._17XNL|MALPY01464|2002-09-10|ds-DNA...    30   1.2  
Plasmodium_yoelii_yoelii_str._17XNL|MALPY01131|2002-09-10|ds-DNA...    28   4.7  
Plasmodium_yoelii_yoelii_str._17XNL|MALPY01118|2002-09-10|ds-DNA...    28   4.7  
Plasmodium_yoelii_yoelii_str._17XNL|MALPY00489|2002-09-10|ds-DNA...    28   4.7  
Plasmodium_yoelii_yoelii_str._17XNL|MALPY00748|2002-09-10|ds-DNA...    28   4.7  

>Plasmodium_yoelii_yoelii_str._17XNL|MALPY00618|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 8197

 Score =  176 bits (89), Expect = 8e-45
 Identities = 89/89 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    gcaccgatgagttagcatggttgctaaagatgacttcaaatcatttggtgtaggtcactg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2292 gcaccgatgagttagcatggttgctaaagatgacttcaaatcatttggtgtaggtcactg 2351

                                         
Query: 61   cacagaggttcgattcctccttcggtgcg 89
            |||||||||||||||||||||||||||||
Sbjct: 2352 cacagaggttcgattcctccttcggtgcg 2380


>Plasmodium_yoelii_yoelii_str._17XNL|MALPY01782|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 11203

 Score = 34.2 bits (17), Expect = 0.076
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 23   gctaaagatgacttcaa 39
            |||||||||||||||||
Sbjct: 5959 gctaaagatgacttcaa 5943


>Plasmodium_yoelii_yoelii_str._17XNL|MALPY01406|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 15024

 Score = 30.2 bits (15), Expect = 1.2
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 38   aaatcatttggtgta 52
            |||||||||||||||
Sbjct: 8169 aaatcatttggtgta 8183


>Plasmodium_yoelii_yoelii_str._17XNL|MALPY01464|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 17045

 Score = 30.2 bits (15), Expect = 1.2
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                           
Query: 39   aatcatttggtgtag 53
            |||||||||||||||
Sbjct: 6570 aatcatttggtgtag 6556


>Plasmodium_yoelii_yoelii_str._17XNL|MALPY01131|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 5816

 Score = 28.2 bits (14), Expect = 4.7
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 38   aaatcatttggtgt 51
            ||||||||||||||
Sbjct: 1599 aaatcatttggtgt 1612


>Plasmodium_yoelii_yoelii_str._17XNL|MALPY01118|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 6189

 Score = 28.2 bits (14), Expect = 4.7
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 69   ttcgattcctcctt 82
            ||||||||||||||
Sbjct: 2034 ttcgattcctcctt 2047


>Plasmodium_yoelii_yoelii_str._17XNL|MALPY00489|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 11680

 Score = 28.2 bits (14), Expect = 4.7
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 40   atcatttggtgtag 53
            ||||||||||||||
Sbjct: 4489 atcatttggtgtag 4502


>Plasmodium_yoelii_yoelii_str._17XNL|MALPY00748|2002-09-10|ds-
            DNA|Plasmodium_yoelii_TIGR
          Length = 42524

 Score = 28.2 bits (14), Expect = 4.7
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 39   aatcatttggtgta 52
            ||||||||||||||
Sbjct: 8416 aatcatttggtgta 8429


  Database: genome.fa
    Posted date:  Mar 4, 2008 11:17 AM
  Number of letters in database: 20,171,213
  Number of sequences in database:  2960
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 2960
Number of Hits to DB: 12,135
Number of extensions: 551
Number of successful extensions: 30
Number of sequences better than 10.0: 8
Number of HSP's gapped: 30
Number of HSP's successfully gapped: 8
Length of query: 89
Length of database: 20,171,213
Length adjustment: 15
Effective length of query: 74
Effective length of database: 20,126,813
Effective search space: 1489384162
Effective search space used: 1489384162
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
S2: 14 (28.2 bits)