------------------------------ ARAGORN v1.2 Dean Laslett ------------------------------ Please reference the following paper if you use this program as part of any published research. Laslett, D. and Canback, B. (2004) ARAGORN, a program for the detection of transfer RNA and transfer-messenger RNA genes in nucleotide sequences. Nucleic Acids Research, 32;11-16. Searching for tRNA genes with no introns Using standard genetic code for anticodon prediction Assuming linear topology, search will not wrap around ends Searching both strands Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|2007-02-22|ds-DNA|Plasmodium_knowlesi_Sanger:subseq(2973908,4000) [revcomp] 4000 nucleotides in sequence Mean G+C content = 37.0% 1. c g a-t c-g c-g g-c a-t t.t g-c tt a ctcc a t g !!!! g g acgatt gagg c g !!!!!! a tt tgctaa c t g g t.tt c a-t g g t-a g t g-c c c a-t g t c a t t t a a t tca g a a tRNA-Sec(tca) 87 bases, %GC = 46.0 Sequence c[3002,3088] 1 . 10 . 20 . 30 . 40 . 50 accgatgagttagcatggttgctaagtatgacttcaaatcatttggcgta gaatttctgcgcagaggttcgattcctccttcggtgc The search took 0 wallclock secs ( 0.03 usr + 0.01 sys = 0.04 CPU)