BLASTN 2.2.17 [Aug-26-2007]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Sel1_seq
(711 letters)
Database: cds.fa
5106 sequences; 11,140,562 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_134330|Annotation|Pla... 311 1e-84
Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_030870|Annotation|Pla... 34 0.39
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_123080|Annotat... 32 1.5
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_125760|Annotat... 32 1.5
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_120440|Annotat... 32 1.5
Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_112100|An... 32 1.5
Plasmodium_knowlesi_strain_H|chr14|PKH_146100|Annotation|Plasmod... 32 1.5
Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_060670|Annotation|Pla... 32 1.5
Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_060690|Annotation|Pla... 32 1.5
Plasmodium_knowlesi_strain_H|chr14|PKH_145120|Annotation|Plasmod... 32 1.5
Plasmodium_knowlesi_strain_H|chr14|PKH_140230|Annotation|Plasmod... 32 1.5
Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_080150|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|chr04|PKH_040150|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr04|PKH_041420|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031840|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082810|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_130420|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_124870|Annotat... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082310|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_125990|Annotat... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_133750|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_132540|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_113360|An... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_090100|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_114300|An... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_134150|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr07|PKH_072060|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092000|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092040|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr05|PKH_052200|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|chr10|PKH_101410|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr10|PKH_101420|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_094130|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|chr14|PKH_141770|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr14|PKH_140450|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr14|PKH_141800|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr14|PKH_143960|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr02|PKH_020900|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_061050|Annotation|Pla... 30 6.1
Plasmodium_knowlesi_strain_H|chr14|PKH_140910|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr14|PKH_146780|Annotation|Plasmod... 30 6.1
Plasmodium_knowlesi_strain_H|chr02|PKH_021090|Annotation|Plasmod... 30 6.1
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_134330|Annotation|Plasmo
dium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 315
Score = 311 bits (157), Expect = 1e-84
Identities = 171/178 (96%)
Strand = Plus / Plus
Query: 1 atgaatcgtaaaaaagaaaaccaagaaaatgagggggaatatgagaacgttttaagagat 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 atgaatcgtaaaaaagaaaaccaagaaaatgagggggaatatgagaacgttttaagagat 60
Query: 61 cgtaaactgaagtatgagaatctgcggnnnnnnngtaccctccataacaggtttatgtcg 120
||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 61 cgtaaactgaagtatgagaatctgcggaaaaaaagtaccctccataacaggtttatgtcg 120
Query: 121 cccatatttaacctaataaatagtgcaataaacttcctgaaaaccctttttaacatag 178
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cccatatttaacctaataaatagtgcaataaacttcctgaaaaccctttttaacatag 178
Score = 139 bits (70), Expect = 9e-33
Identities = 70/70 (100%)
Strand = Plus / Plus
Query: 642 aaaaatgggaactttgcaaaaaagcagaatgatggaactgaagaatttgggcacctgttt 701
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243 aaaaatgggaactttgcaaaaaagcagaatgatggaactgaagaatttgggcacctgttt 302
Query: 702 gggaagctcc 711
||||||||||
Sbjct: 303 gggaagctcc 312
Score = 129 bits (65), Expect = 9e-30
Identities = 65/65 (100%)
Strand = Plus / Plus
Query: 287 gcagcacttccgtccgcttaccccttgcggaacaatagcgtgtgtacagcccttcaacaa 346
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 178 gcagcacttccgtccgcttaccccttgcggaacaatagcgtgtgtacagcccttcaacaa 237
Query: 347 atgat 351
|||||
Sbjct: 238 atgat 242
>Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_030870|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2181
Score = 34.2 bits (17), Expect = 0.39
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 10 aaaaaagaaaaccaagaaaat 30
||||||||||||||| |||||
Sbjct: 1084 aaaaaagaaaaccaaaaaaat 1104
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_123080|Annotation
|Plasmodium_knowlesi_Sanger|(protein coding)
hypothetical protein, conserved in Plasmodium species
Length = 3828
Score = 32.2 bits (16), Expect = 1.5
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 631 aacaagaagagaaaaa 646
||||||||||||||||
Sbjct: 278 aacaagaagagaaaaa 293
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_125760|Annotation
|Plasmodium_knowlesi_Sanger|(protein coding)
hypothetical protein, conserved in Plasmodium species
Length = 933
Score = 32.2 bits (16), Expect = 1.5
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 432 cctttttaacaaccat 447
||||||||||||||||
Sbjct: 457 cctttttaacaaccat 442
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_120440|Annotation|P
lasmodium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 7893
Score = 32.2 bits (16), Expect = 1.5
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 634 aagaagagaaaaatgg 649
||||||||||||||||
Sbjct: 1426 aagaagagaaaaatgg 1441
>Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_112100|Annotat
ion|Plasmodium_knowlesi_Sanger|(protein coding)
ethanolaminephosphotransferase, putative
Length = 1191
Score = 32.2 bits (16), Expect = 1.5
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 628 ttcaacaagaagagaaaaat 647
||||||||||||| ||||||
Sbjct: 1150 ttcaacaagaagaaaaaaat 1169
>Plasmodium_knowlesi_strain_H|chr14|PKH_146100|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 5283
Score = 32.2 bits (16), Expect = 1.5
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 343 acaaatgatgttaata 358
||||||||||||||||
Sbjct: 2758 acaaatgatgttaata 2773
>Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_060670|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Apicomplexan species
Length = 2658
Score = 32.2 bits (16), Expect = 1.5
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 637 aagagaaaaatgggaa 652
||||||||||||||||
Sbjct: 2220 aagagaaaaatgggaa 2235
>Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_060690|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) GcpE protein,
putative
Length = 2442
Score = 32.2 bits (16), Expect = 1.5
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 162 aaccctttttaacata 177
||||||||||||||||
Sbjct: 2178 aaccctttttaacata 2193
>Plasmodium_knowlesi_strain_H|chr14|PKH_145120|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 10287
Score = 32.2 bits (16), Expect = 1.5
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 493 atgcatatttctacaa 508
||||||||||||||||
Sbjct: 3821 atgcatatttctacaa 3836
>Plasmodium_knowlesi_strain_H|chr14|PKH_140230|Annotation|Plasmodium_kno
wlesi_Sanger|(protein coding) peptidase, putative
Length = 25959
Score = 32.2 bits (16), Expect = 1.5
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 204 agaagcacataaacgttttg 223
|||||||||||| |||||||
Sbjct: 15169 agaagcacataagcgttttg 15150
>Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_080150|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) DnaJ protein,
putative
Length = 4344
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 634 aagaagagaaaaatg 648
|||||||||||||||
Sbjct: 1951 aagaagagaaaaatg 1965
>Plasmodium_knowlesi_strain_H|chr04|PKH_040150|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 4653
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 13 aaagaaaaccaagaa 27
|||||||||||||||
Sbjct: 4274 aaagaaaaccaagaa 4288
>Plasmodium_knowlesi_strain_H|chr04|PKH_041420|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2013
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 659 aaaaaagcagaatga 673
|||||||||||||||
Sbjct: 1083 aaaaaagcagaatga 1097
>Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031840|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 9687
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 163 accctttttaacata 177
|||||||||||||||
Sbjct: 2599 accctttttaacata 2613
>Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082810|Annotation|Plasmo
dium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 1842
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 524 acaaatgtgtgtatt 538
|||||||||||||||
Sbjct: 955 acaaatgtgtgtatt 941
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_130420|Annotation|Plas
modium_knowlesi_Sanger|(protein coding) Glyoxalase II,
putative
Length = 1068
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 10 aaaaaagaaaaccaa 24
|||||||||||||||
Sbjct: 36 aaaaaagaaaaccaa 22
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_124870|Annotation|P
lasmodium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 9147
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 11 aaaaagaaaaccaag 25
|||||||||||||||
Sbjct: 8108 aaaaagaaaaccaag 8122
>Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082310|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) dna-directed rna
polymerase ii, putative
Length = 7062
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 102 ccataacaggtttat 116
|||||||||||||||
Sbjct: 1669 ccataacaggtttat 1655
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_125990|Annotation
|Plasmodium_knowlesi_Sanger|(protein coding)
hypothetical protein, conserved in in Plasmodium species
Length = 8625
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 611 acggagatgatgatt 625
|||||||||||||||
Sbjct: 800 acggagatgatgatt 814
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_133750|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) cytidine triphosphate
synthetase, putative
Length = 2553
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 634 aagaagagaaaaatg 648
|||||||||||||||
Sbjct: 1252 aagaagagaaaaatg 1266
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_132540|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 4254
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 635 agaagagaaaaatgg 649
|||||||||||||||
Sbjct: 4058 agaagagaaaaatgg 4072
>Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_113360|Annotat
ion|Plasmodium_knowlesi_Sanger|(protein coding)
ribonuclease, putative
Length = 7914
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 633 caagaagagaaaaat 647
|||||||||||||||
Sbjct: 7746 caagaagagaaaaat 7760
>Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_090100|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) CCR4-Not complex
subunit, putative
Length = 10002
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 123 catatttaacctaat 137
|||||||||||||||
Sbjct: 4395 catatttaacctaat 4409
>Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_114300|Annot
ation|Plasmodium_knowlesi_Sanger|(protein coding)
ubiquitin-conjugating enzyme E2, putative
Length = 459
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 660 aaaaagcagaatgat 674
|||||||||||||||
Sbjct: 40 aaaaagcagaatgat 54
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_134150|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 4260
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 469 tgtggttgtagaggg 483
|||||||||||||||
Sbjct: 2425 tgtggttgtagaggg 2411
>Plasmodium_knowlesi_strain_H|PK4.chr07|PKH_072060|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 3474
Score = 30.2 bits (15), Expect = 6.1
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 190 ttattgcgcacaaaagaag 208
||||||| |||||||||||
Sbjct: 2345 ttattgcccacaaaagaag 2327
>Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092000|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 5607
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 488 ctcatatgcatattt 502
|||||||||||||||
Sbjct: 2439 ctcatatgcatattt 2425
>Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092040|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) dynein heavy chain,
putative
Length = 15663
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 13 aaagaaaaccaagaa 27
|||||||||||||||
Sbjct: 3853 aaagaaaaccaagaa 3867
>Plasmodium_knowlesi_strain_H|PK4.chr05|PKH_052200|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2166
Score = 30.2 bits (15), Expect = 6.1
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 539 ctcaactgtacatgtaacc 557
|||||||||||| ||||||
Sbjct: 1738 ctcaactgtacaagtaacc 1756
>Plasmodium_knowlesi_strain_H|chr10|PKH_101410|Annotation|Plasmodium
_knowlesi_Sanger|(protein coding) WD repeat protein,
putative
Length = 3603
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 513 catgcgtacacacaa 527
|||||||||||||||
Sbjct: 265 catgcgtacacacaa 279
>Plasmodium_knowlesi_strain_H|chr10|PKH_101420|Annotation|Plasmodium
_knowlesi_Sanger|(protein coding) snrnp protein,
putative
Length = 3006
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 25 gaaaatgagggggaa 39
|||||||||||||||
Sbjct: 187 gaaaatgagggggaa 201
>Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_094130|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2469
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 635 agaagagaaaaatgg 649
|||||||||||||||
Sbjct: 1931 agaagagaaaaatgg 1945
>Plasmodium_knowlesi_strain_H|chr14|PKH_141770|Annotation|Plasmodium
_knowlesi_Sanger|(protein coding) chromosome segregation
protein, putative
Length = 3654
Score = 30.2 bits (15), Expect = 6.1
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 250 ataatatatgtatgcaatt 268
||||||| |||||||||||
Sbjct: 723 ataatatttgtatgcaatt 705
>Plasmodium_knowlesi_strain_H|chr14|PKH_140450|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 3774
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 423 aaatgtaaccctttt 437
|||||||||||||||
Sbjct: 3732 aaatgtaaccctttt 3718
>Plasmodium_knowlesi_strain_H|chr14|PKH_141800|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) DNAJ-like Sec63
homologue, putative
Length = 2085
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 676 gaactgaagaatttg 690
|||||||||||||||
Sbjct: 1044 gaactgaagaatttg 1030
>Plasmodium_knowlesi_strain_H|chr14|PKH_143960|Annotation|Plasmodium
_knowlesi_Sanger|(protein coding) CAMP-dependent protein
kinase regulatory subunit, putative
Length = 1260
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 634 aagaagagaaaaatg 648
|||||||||||||||
Sbjct: 826 aagaagagaaaaatg 840
>Plasmodium_knowlesi_strain_H|chr02|PKH_020900|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 7920
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 632 acaagaagagaaaaa 646
|||||||||||||||
Sbjct: 6819 acaagaagagaaaaa 6833
>Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_061050|Annotation|Plasmo
dium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 1059
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 609 cgacggagatgatga 623
|||||||||||||||
Sbjct: 675 cgacggagatgatga 689
>Plasmodium_knowlesi_strain_H|chr14|PKH_140910|Annotation|Plasmodium
_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 435
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 163 accctttttaacata 177
|||||||||||||||
Sbjct: 205 accctttttaacata 219
>Plasmodium_knowlesi_strain_H|chr14|PKH_146780|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) pfg377 homolog, putative
Length = 7716
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 197 gcacaaaagaagcac 211
|||||||||||||||
Sbjct: 1996 gcacaaaagaagcac 2010
>Plasmodium_knowlesi_strain_H|chr02|PKH_021090|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) ubiquitin
carboxyl-terminal hydrolase, putative
Length = 8901
Score = 30.2 bits (15), Expect = 6.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 424 aatgtaacccttttt 438
|||||||||||||||
Sbjct: 4782 aatgtaacccttttt 4768
Database: cds.fa
Posted date: Mar 7, 2008 5:54 PM
Number of letters in database: 11,140,562
Number of sequences in database: 5106
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 5106
Number of Hits to DB: 99,718
Number of extensions: 6606
Number of successful extensions: 560
Number of sequences better than 10.0: 42
Number of HSP's gapped: 559
Number of HSP's successfully gapped: 44
Length of query: 711
Length of database: 11,140,562
Length adjustment: 17
Effective length of query: 694
Effective length of database: 11,053,760
Effective search space: 7671309440
Effective search space used: 7671309440
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
S2: 15 (30.2 bits)
