BLASTN 2.2.17 [Aug-26-2007]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Plasmodium_knowlesi_strain_H|PK4.chr03|2007-02-22|ds-
DNA|Plasmodium_knowlesi_Sanger:subseq(566000,7000)
(7000 letters)
Database: cds.fa
5106 sequences; 11,140,562 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031130|Annotation|Pla... 1943 0.0
Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031120|Annotation|Pla... 244 2e-63
Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031110|Annotation|Pla... 145 2e-33
Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_081930|Annotation|Pla... 36 0.99
Plasmodium_knowlesi_strain_H|PK4.chr01|PKH_010500|Annotation|Pla... 36 0.99
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_133610|Annotation|Pla... 36 0.99
Plasmodium_knowlesi_strain_H|chr10|PKH_102770|Annotation|Plasmod... 36 0.99
Plasmodium_knowlesi_strain_H|chr10|PKH_102910|Annotation|Plasmod... 36 0.99
Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092440|Annotation|Pla... 36 0.99
Plasmodium_knowlesi_strain_H|chr10|PKH_102240|Annotation|Plasmod... 36 0.99
Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_080680|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|chr04|PKH_040960|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|chr04|PKH_041710|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_061400|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_123310|Annotat... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082860|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_121450|Annotat... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_122860|Annotat... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_126160|Annotat... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_123560|Annotat... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082430|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_126370|Annotat... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_131410|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_132210|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_134370|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_114840|An... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr01|PKH_011390|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr05|PKH_051890|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|chr10|PKH_101790|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092810|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr07|PKH_070320|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_093840|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|chr14|PKH_141130|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_060590|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|chr14|PKH_144900|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|chr02|PKH_021350|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|chr14|PKH_140180|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|chr14|PKH_140230|Annotation|Plasmod... 34 3.9
Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_061100|Annotation|Pla... 34 3.9
Plasmodium_knowlesi_strain_H|chr14|PKH_142300|Annotation|Plasmod... 34 3.9
>Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031130|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2475
Score = 1943 bits (980), Expect = 0.0
Identities = 980/980 (100%)
Strand = Plus / Plus
Query: 6021 agggaccgcactcccagcgactaccttaacatgaagaagagcaaactgattaacaactta 6080
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 agggaccgcactcccagcgactaccttaacatgaagaagagcaaactgattaacaactta 519
Query: 6081 aattttttcatgcgcgtctgttgcaacaagaactcatatataaaattcattaatcactac 6140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 520 aattttttcatgcgcgtctgttgcaacaagaactcatatataaaattcattaatcactac 579
Query: 6141 tttaacataatttattgcaacaacatcagcctactatttatgtatgagggtattttgcaa 6200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 580 tttaacataatttattgcaacaacatcagcctactatttatgtatgagggtattttgcaa 639
Query: 6201 aagttcgatgagcggaatgaaatgaatttaacggagaatgattattacaatgggtatgtg 6260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 640 aagttcgatgagcggaatgaaatgaatttaacggagaatgattattacaatgggtatgtg 699
Query: 6261 aaactgaaccaggtgcctatagtgatatatggaaatgggggtagtgtgagtgaaaggaat 6320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 700 aaactgaaccaggtgcctatagtgatatatggaaatgggggtagtgtgagtgaaaggaat 759
Query: 6321 ggagcggacgggagaagtggagataacggtgtaggggataacgatgtaggagataacggt 6380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 760 ggagcggacgggagaagtggagataacggtgtaggggataacgatgtaggagataacggt 819
Query: 6381 gtaggagataacggtgtaggagataaaggtgtagggggtatcgggacaagcgacgtttgt 6440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 820 gtaggagataacggtgtaggagataaaggtgtagggggtatcgggacaagcgacgtttgt 879
Query: 6441 ccaaacggaagaagttctggaacccccctgagcgaaataaaaatagacatggacacgaat 6500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 880 ccaaacggaagaagttctggaacccccctgagcgaaataaaaatagacatggacacgaat 939
Query: 6501 caagagcgcctgagaaacaattctaacctcgaaagcagcgtattgaatttcattaacatt 6560
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940 caagagcgcctgagaaacaattctaacctcgaaagcagcgtattgaatttcattaacatt 999
Query: 6561 tacgataatttgacagtcaactttttcaatcatatattcactaaaattaacaacaaggaa 6620
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1000 tacgataatttgacagtcaactttttcaatcatatattcactaaaattaacaacaaggaa 1059
Query: 6621 atgaacatacataattcgaacatagaccttatcatacataattttctgcacaagaagcat 6680
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060 atgaacatacataattcgaacatagaccttatcatacataattttctgcacaagaagcat 1119
Query: 6681 ctgctaaaggaaaatatttttaatttgttactaaacattagtaagtcttatgaaatgaaa 6740
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1120 ctgctaaaggaaaatatttttaatttgttactaaacattagtaagtcttatgaaatgaaa 1179
Query: 6741 tatagtagtattcttgcagagataaaaaatgacgaacacgtgaaggagagaaatgagaaa 6800
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1180 tatagtagtattcttgcagagataaaaaatgacgaacacgtgaaggagagaaatgagaaa 1239
Query: 6801 ataattttcgaaatgttgaaggacaaggtggaggggcgcttcggcggttatagaagtaag 6860
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1240 ataattttcgaaatgttgaaggacaaggtggaggggcgcttcggcggttatagaagtaag 1299
Query: 6861 ggtcaaaccccttgggcagtgcattcttctgtgcgcggcgatgagagtaacggtttgtat 6920
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1300 ggtcaaaccccttgggcagtgcattcttctgtgcgcggcgatgagagtaacggtttgtat 1359
Query: 6921 ggcgcgctacatggagatcatctcgatgtgtaccacggagcggagtacaattcccagaat 6980
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1360 ggcgcgctacatggagatcatctcgatgtgtaccacggagcggagtacaattcccagaat 1419
Query: 6981 ttctcctcgtacggttcttg 7000
||||||||||||||||||||
Sbjct: 1420 ttctcctcgtacggttcttg 1439
Score = 910 bits (459), Expect = 0.0
Identities = 459/459 (100%)
Strand = Plus / Plus
Query: 5308 atgttttctcaaggagaggagacgaaaatttactttcccgagtttatgctgaatggttct 5367
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 atgttttctcaaggagaggagacgaaaatttactttcccgagtttatgctgaatggttct 60
Query: 5368 ggctgctacaacatcgccgaaggagattccttgggtctgaattacatgaataatctaaga 5427
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 ggctgctacaacatcgccgaaggagattccttgggtctgaattacatgaataatctaaga 120
Query: 5428 aaacaatttttaaattttaagagccttcaaaagaatcatgtggacgatgcgaaggttgat 5487
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 aaacaatttttaaattttaagagccttcaaaagaatcatgtggacgatgcgaaggttgat 180
Query: 5488 tgtcagaagagtgtgggatgcggagtgcatgcagttggtgtcggaaacccaagtgggaat 5547
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tgtcagaagagtgtgggatgcggagtgcatgcagttggtgtcggaaacccaagtgggaat 240
Query: 5548 gacagtggccacggaaatatgaatagatataagagtggggaggttagcggagaggtcacc 5607
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gacagtggccacggaaatatgaatagatataagagtggggaggttagcggagaggtcacc 300
Query: 5608 caggaggtttccggtatgatgaacggaaaaggtatcgtagaacgtatgtcgcagagcaat 5667
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 caggaggtttccggtatgatgaacggaaaaggtatcgtagaacgtatgtcgcagagcaat 360
Query: 5668 ggagaaacccccgaggaaggaactgcaggccccagaggcaaacaggacagaggagagtta 5727
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 ggagaaacccccgaggaaggaactgcaggccccagaggcaaacaggacagaggagagtta 420
Query: 5728 gccatcggattggagaacaaaagctccatgaaccccgac 5766
|||||||||||||||||||||||||||||||||||||||
Sbjct: 421 gccatcggattggagaacaaaagctccatgaaccccgac 459
>Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031120|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein
Length = 381
Score = 244 bits (123), Expect = 2e-63
Identities = 123/123 (100%)
Strand = Plus / Plus
Query: 2652 agaaggttattctcgctttctacatgcttatacattcgcacatataaatccctttgcatg 2711
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138 agaaggttattctcgctttctacatgcttatacattcgcacatataaatccctttgcatg 197
Query: 2712 tgctcattttgaacatttctacgtaagaattttttgcacaggtggaagcctttgctctag 2771
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 tgctcattttgaacatttctacgtaagaattttttgcacaggtggaagcctttgctctag 257
Query: 2772 gca 2774
|||
Sbjct: 258 gca 260
Score = 196 bits (99), Expect = 5e-49
Identities = 99/99 (100%)
Strand = Plus / Plus
Query: 2485 tatccatgtgttggtactctcctcgaatttacatatgtgcacagggacatgtgcagcacg 2544
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 39 tatccatgtgttggtactctcctcgaatttacatatgtgcacagggacatgtgcagcacg 98
Query: 2545 cggtacgcgatttaggtatgcccgtcgtttggaatcaca 2583
|||||||||||||||||||||||||||||||||||||||
Sbjct: 99 cggtacgcgatttaggtatgcccgtcgtttggaatcaca 137
Score = 75.8 bits (38), Expect = 1e-12
Identities = 38/38 (100%)
Strand = Plus / Plus
Query: 2209 atgcgatcgcatttttatgctcgaattcgtggaattca 2246
||||||||||||||||||||||||||||||||||||||
Sbjct: 1 atgcgatcgcatttttatgctcgaattcgtggaattca 38
Score = 58.0 bits (29), Expect = 3e-07
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 3099 cgaagagacagttttgaatttccatggcg 3127
|||||||||||||||||||||||||||||
Sbjct: 261 cgaagagacagttttgaatttccatggcg 289
Score = 52.0 bits (26), Expect = 2e-05
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 3312 tggaggtccataagggtgaattgtga 3337
||||||||||||||||||||||||||
Sbjct: 356 tggaggtccataagggtgaattgtga 381
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 3144 acatatgctatatttgaa 3161
||||||||||||||||||
Sbjct: 306 acatatgctatatttgaa 323
>Plasmodium_knowlesi_strain_H|PK4.chr03|PKH_031110|Annotation|Plasmo
dium_knowlesi_Sanger|(protein coding) hypothetical
protein
Length = 672
Score = 145 bits (73), Expect = 2e-33
Identities = 73/73 (100%)
Strand = Plus / Plus
Query: 199 atgtgcaaccgaacgggtgagtatatcgccaaagggtgcctgtaataatttgcgtgtcat 258
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 480 atgtgcaaccgaacgggtgagtatatcgccaaagggtgcctgtaataatttgcgtgtcat 539
Query: 259 tttgtacgtttgc 271
|||||||||||||
Sbjct: 540 tttgtacgtttgc 552
Score = 129 bits (65), Expect = 9e-29
Identities = 65/65 (100%)
Strand = Plus / Plus
Query: 437 agcctttggcacgcccacctccggggagcgtggacgcatacacaccagctatatgcccat 496
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 553 agcctttggcacgcccacctccggggagcgtggacgcatacacaccagctatatgcccat 612
Query: 497 ctgcg 501
|||||
Sbjct: 613 ctgcg 617
Score = 111 bits (56), Expect = 2e-23
Identities = 56/56 (100%)
Strand = Plus / Plus
Query: 631 gaattgacatctgcgcgtcagcgagaatgtgcatacgacccagggcccatgtgtga 686
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 617 gaattgacatctgcgcgtcagcgagaatgtgcatacgacccagggcccatgtgtga 672
Score = 105 bits (53), Expect = 1e-21
Identities = 53/53 (100%)
Strand = Plus / Plus
Query: 94 gaaaatgtcgtagtggacacaaaaagcatttacacatgcaagcagcaagggga 146
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 427 gaaaatgtcgtagtggacacaaaaagcatttacacatgcaagcagcaagggga 479
>Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_081930|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2325
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 5038 tttttcttcccttttatt 5055
||||||||||||||||||
Sbjct: 1317 tttttcttcccttttatt 1300
>Plasmodium_knowlesi_strain_H|PK4.chr01|PKH_010500|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 1794
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1003 agcacttttaaaaagggg 1020
||||||||||||||||||
Sbjct: 1568 agcacttttaaaaagggg 1551
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_133610|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2748
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 3262 atacagaaaaaggaaaag 3279
||||||||||||||||||
Sbjct: 103 atacagaaaaaggaaaag 120
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 6603 aaaattaacaacaagga 6619
|||||||||||||||||
Sbjct: 382 aaaattaacaacaagga 398
>Plasmodium_knowlesi_strain_H|chr10|PKH_102770|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 1617
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 6686 aaaggaaaatatttttaa 6703
||||||||||||||||||
Sbjct: 767 aaaggaaaatatttttaa 784
>Plasmodium_knowlesi_strain_H|chr10|PKH_102910|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 1680
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 3267 gaaaaaggaaaagtacaa 3284
||||||||||||||||||
Sbjct: 111 gaaaaaggaaaagtacaa 128
>Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092440|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) SICAvar antigen
(fragment)
Length = 2994
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 5035 aattttttcttccctttt 5052
||||||||||||||||||
Sbjct: 1698 aattttttcttccctttt 1681
>Plasmodium_knowlesi_strain_H|chr10|PKH_102240|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) topoisomerase I, putative
Length = 2775
Score = 36.2 bits (18), Expect = 0.99
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 5080 cagtgtcttttttcccct 5097
||||||||||||||||||
Sbjct: 409 cagtgtcttttttcccct 392
>Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_080680|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) histone deacetylase,
putative
Length = 6402
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 535 aaagaaaaaggaacgaa 551
|||||||||||||||||
Sbjct: 3082 aaagaaaaaggaacgaa 3098
>Plasmodium_knowlesi_strain_H|chr04|PKH_040960|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 3702
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 526 attggagaaaaagaaaaagga 546
|||||||||||| ||||||||
Sbjct: 2088 attggagaaaaataaaaagga 2108
>Plasmodium_knowlesi_strain_H|chr04|PKH_041710|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) polyprenyl synthetase,
putative
Length = 1569
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3243 tctcctacgtgatgatgtaat 3263
|||||||| ||||||||||||
Sbjct: 789 tctcctacatgatgatgtaat 809
>Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_061400|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2373
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 5123 ccttttgaattcttcga 5139
|||||||||||||||||
Sbjct: 1326 ccttttgaattcttcga 1310
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_123310|Annotation
|Plasmodium_knowlesi_Sanger|(protein coding) histone
deactylase, putative
Length = 4545
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 526 attggagaaaaagaaaa 542
|||||||||||||||||
Sbjct: 653 attggagaaaaagaaaa 637
>Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082860|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) protein kinase,
putative
Length = 8484
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 2342 gtttctttcatttaaatgaag 2362
|||||||| ||||||||||||
Sbjct: 3056 gtttctttgatttaaatgaag 3076
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_121450|Annotation|P
lasmodium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 1428
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 6687 aaggaaaatatttttaa 6703
|||||||||||||||||
Sbjct: 162 aaggaaaatatttttaa 146
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_122860|Annotation|P
lasmodium_knowlesi_Sanger|(protein coding) helicase,
putative
Length = 3159
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 5036 attttttcttccctttt 5052
|||||||||||||||||
Sbjct: 2137 attttttcttccctttt 2121
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_126160|Annotation|P
lasmodium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 621
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1666 tatatacataaaatttt 1682
|||||||||||||||||
Sbjct: 139 tatatacataaaatttt 123
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_123560|Annotation|P
lasmodium_knowlesi_Sanger|(protein coding) biotin
carboxylase subunit of acetyl CoA carboxylase, putative
Length = 8766
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 6331 ggagaagtggagataac 6347
|||||||||||||||||
Sbjct: 272 ggagaagtggagataac 288
>Plasmodium_knowlesi_strain_H|PK4.chr08|PKH_082430|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 2490
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 2753 gtggaagcctttgctct 2769
|||||||||||||||||
Sbjct: 2313 gtggaagcctttgctct 2297
>Plasmodium_knowlesi_strain_H|PK4.chr12.pseudo|PKH_126370|Annotation|P
lasmodium_knowlesi_Sanger|(protein coding) hypothetical
protein, conserved in Plasmodium species
Length = 5907
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3262 atacagaaaaaggaaaagtac 3282
||||||||| |||||||||||
Sbjct: 3290 atacagaaagaggaaaagtac 3310
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_131410|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 1152
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 531 agaaaaagaaaaaggaa 547
|||||||||||||||||
Sbjct: 1016 agaaaaagaaaaaggaa 1032
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_132210|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) SICAvar antigen
(fragment)
Length = 3875
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 5035 aattttttcttcccttt 5051
|||||||||||||||||
Sbjct: 2528 aattttttcttcccttt 2512
>Plasmodium_knowlesi_strain_H|PK4.chr13|PKH_134370|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 4803
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 6686 aaaggaaaatattttta 6702
|||||||||||||||||
Sbjct: 3310 aaaggaaaatattttta 3294
>Plasmodium_knowlesi_strain_H|PK4.chr11.pseudo.embl|PKH_114840|Annot
ation|Plasmodium_knowlesi_Sanger|(protein coding)
hypothetical protein, conserved in Plasmodium species
Length = 822
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 531 agaaaaagaaaaaggaa 547
|||||||||||||||||
Sbjct: 674 agaaaaagaaaaaggaa 690
>Plasmodium_knowlesi_strain_H|PK4.chr01|PKH_011390|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 6405
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 6463 cccccctgagcgaaataaaaa 6483
|||||||||||||| ||||||
Sbjct: 530 cccccctgagcgaattaaaaa 550
>Plasmodium_knowlesi_strain_H|PK4.chr05|PKH_051890|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved
Length = 5346
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 527 ttggagaaaaagaaaaaggaa 547
||||||||||| |||||||||
Sbjct: 1453 ttggagaaaaaaaaaaaggaa 1473
>Plasmodium_knowlesi_strain_H|chr10|PKH_101790|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 4107
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 5038 tttttcttcccttttat 5054
|||||||||||||||||
Sbjct: 3072 tttttcttcccttttat 3056
>Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_092810|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 3123
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 6069 attaacaacttaaattttttc 6089
||||||||||| |||||||||
Sbjct: 559 attaacaactttaattttttc 579
>Plasmodium_knowlesi_strain_H|PK4.chr07|PKH_070320|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 7221
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3223 gaatttacaaaagagta 3239
|||||||||||||||||
Sbjct: 3513 gaatttacaaaagagta 3529
>Plasmodium_knowlesi_strain_H|PK4.chr09|PKH_093840|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 9030
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3267 gaaaaaggaaaagtaca 3283
|||||||||||||||||
Sbjct: 5847 gaaaaaggaaaagtaca 5863
>Plasmodium_knowlesi_strain_H|chr14|PKH_141130|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 3735
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3268 aaaaaggaaaagtacaa 3284
|||||||||||||||||
Sbjct: 2644 aaaaaggaaaagtacaa 2660
>Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_060590|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 5850
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 527 ttggagaaaaagaaaaa 543
|||||||||||||||||
Sbjct: 4249 ttggagaaaaagaaaaa 4265
>Plasmodium_knowlesi_strain_H|chr14|PKH_144900|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 3084
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 5036 attttttcttccctttt 5052
|||||||||||||||||
Sbjct: 927 attttttcttccctttt 911
>Plasmodium_knowlesi_strain_H|chr02|PKH_021350|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 7671
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 529 ggagaaaaagaaaaagg 545
|||||||||||||||||
Sbjct: 2773 ggagaaaaagaaaaagg 2789
>Plasmodium_knowlesi_strain_H|chr14|PKH_140180|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 936
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 6687 aaggaaaatatttttaa 6703
|||||||||||||||||
Sbjct: 352 aaggaaaatatttttaa 368
>Plasmodium_knowlesi_strain_H|chr14|PKH_140230|Annotation|Plasmodium_kno
wlesi_Sanger|(protein coding) peptidase, putative
Length = 25959
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 4679 gagataattttatactg 4695
|||||||||||||||||
Sbjct: 18436 gagataattttatactg 18452
>Plasmodium_knowlesi_strain_H|PK4.chr06|PKH_061100|Annotation|Plasmodi
um_knowlesi_Sanger|(protein coding) hypothetical protein,
conserved in Plasmodium species
Length = 5175
Score = 34.2 bits (17), Expect = 3.9
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3264 acagaaaaaggaaaagt 3280
|||||||||||||||||
Sbjct: 993 acagaaaaaggaaaagt 1009
>Plasmodium_knowlesi_strain_H|chr14|PKH_142300|Annotation|Plasmodium_k
nowlesi_Sanger|(protein coding) Zinc transporter,
putative
Length = 1731
Score = 34.2 bits (17), Expect = 3.9
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 6125 attcattaatcactactttaa 6145
||||||||||| |||||||||
Sbjct: 955 attcattaatccctactttaa 935
Database: cds.fa
Posted date: Mar 12, 2008 5:11 PM
Number of letters in database: 11,140,562
Number of sequences in database: 5106
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 5106
Number of Hits to DB: 933,154
Number of extensions: 60520
Number of successful extensions: 1599
Number of sequences better than 10.0: 40
Number of HSP's gapped: 1593
Number of HSP's successfully gapped: 50
Length of query: 7000
Length of database: 11,140,562
Length adjustment: 18
Effective length of query: 6982
Effective length of database: 11,048,654
Effective search space: 77141702228
Effective search space used: 77141702228
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
S2: 17 (34.2 bits)
