Blast 2 Sequences results

BLAST 2 SEQUENCES RESULTS VERSION BLASTN 2.2.6 [Apr-09-2003]

Match: Mismatch: gap open: gap extension:
x_dropoff: expect: wordsize: Filter

---

Sequence 1	gb|AADE01000300.1|:34166-36166	Drosophila pseudoobscura chromosome XR strain MV	Length	2019	(1 .. 2019)
Sequence 2	lcl|tmpseq_0	assembly=DROM3A|chr=3L|strand=forward|bases	Length	144	(1 .. 144)

2

1

NOTE:The statistics (bitscore and expect value) is calculated based on the size of nr database

NOTE:If protein translation is reversed, please repeat the search with reverse strand of the query sequence

Score = 64.1 bits (33), Expect = 6e-08
Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 579 tttctgcgtcgtctggtcgtgtaaggaaactctaagggcagc 620
           |||||||||||||||||||| ||||||||||||  |||||||
Sbjct: 136 tttctgcgtcgtctggtcgtttaaggaaactctgcgggcagc 95

CPU time:     0.00 user secs.	    0.00 sys. secs	    0.00 total secs.

Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.33    0.621     1.12 


Matrix: blastn matrix:1 -2
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 40
Number of Sequences: 0
Number of extensions: 40
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 1
length of query: 144
length of database: 10,130,642,339
effective HSP length: 24
effective length of query: 120
effective length of database: 10,130,642,315
effective search space: 1215677077800
effective search space used: 1215677077800
T: 0
A: 0
X1: 6 (11.5 bits)
X2: 26 (50.0 bits)
S1: 12 (23.8 bits)
S2: 19 (37.2 bits)